Genetic tools for metabolic enzyme production in Escherichia coli

1. Genetic tools for metabolic enzyme production in Escherichia coli Jay D. Keasling Department of Chemical Engineering University of California Berkeley, CA 94720

2. Essential oils Menthol C-10 Monoterpene Carotenoids Lycopene C-40 Tetraterpene Terpenoids Chemotherapeutics > 50,000 known molecules Eleutherobin C-20 Diterpene Taxol C-20 diterpene

3. Terpenoid metabolic pathways

4. The DXP pathway pyridoxine thiamine Pyruvate 4-diphospho-2C-methyl-D-erythritol Dxs Dxr IspD 2C-methyl-D-erythritol-4-phosphate (MEP) 1-deoxy-D-xylulose-5-phosphate (DXP) D-glyceraldehyde- 3-phosphate (G3P) IspE IspF Isopentenyl Pyrophosphate (IPP) IspG IspH 4-diphosphocytidyl-2C-methyl- D-erythritol-2-phosphate 2C-methyl-D-erythritol 2,4-cyclodiphosphate 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate Dimethylallyl Pyrophosphate (DMAPP)

5. The mevalonate pathway

6. O O O O O Artemisinin Artemisia annua

7. O O O O O Artemisinin-based drugs • The current cost for an artemisinin-based drug is approximately $2.25. • Artemisinin generally adds $1.00-1.50 to the cost for drugs • Most developing countries spend less than $4/person/year on health care • As many as 10-12 treatments are needed for each person annually • World Health Organization estimates that 700 tons will be needed annually

8. Microbial production of artemisinin • Advantages • Microbial fermentations are relatively simple to scale up • Inexpensive starting materials can be used • Challenges • Need the genes for all of the enzymes in the pathway • Not always simple to express in microbes the genes from very different organisms • Need to balance metabolic pathways to optimize production • Need a good “platform organism” with appropriate gene expression tools

9. Synthesis of artemisinin in E. coli Identify the enzymes

10. Clone the genes Synthesis of artemisinin in E. coli

11. Synthesis of artemisinin in E. coli Well characterized parts to control gene expression

12. Synthesis of artemisinin in E. coli Supply of intracellular precursors

13. Gene expression tools for metabolic engineering Plasmid

14. A Enzyme 1 Enzyme 3 Enzyme 4 X Y1 Z B Y2 C Enzyme 2 A Enzyme 1 Enzyme 3 Enzyme 4 X Y1 Z B Y2 C Enzyme 2 Plasmid copy number can influence gene expression levels High-copy plasmid Low-copy plasmid

15. dxs expressed from a high-copy plasmid DMAPP DXS Pyr + G3P IPP FPP High-copy plasmid CrtE dxs Ptac CrtI CrtY Carotenoids crtE crtI crtY Pconst

16. 7 6 5 4 Cell Growth (OD570) 3 2 1 0 Carotenoid production in cells expressing dxs from a high-copy plasmid 7 6 5 4 Carotenoid (mg/ml) 3 2 1 0 0 0.3 0.6 0.9 IPTG concentration (mM)

17. E E 5 34 43 45 48 64 kb Bacterial Artificial Chromosome (BAC) 0 F plasmid 25 75 50 ccd Tn1000 oriS flm oriV par E H B P rep FIA rep FIB Native F plasmid of Escherichia coli

18. BACs are stable indefinitely in the absence of selection pressure 1 Gene expression 0.8 induced Not induced 0.6 Fraction plasmid- bearing cells 0.4 0.2 0 0 40 80 120 160 Culture time (generations)

19. Commonly-used high-copy plasmids are segregatively unstable 1 Not induced 0.8 Fraction plasmid- bearing cells 0.6 Gene expression 0.4 induced 0.2 0 0 40 80 120 160 Culture time (generations)

20. The auxiliary chromosomes have improved control of gene expression Uninduced Expression Induced Expression Growth Rate of Host 15 units 4,000 units 0.69 hr-1 BAC High-Copy Plasmid 200 units 12,500 units 0.53 hr-1

21. dxs expressed from a bacterial artificial chromosome DMAPP DXS Pyr + G3P IPP FPP Bacterial artificial chromosome araC CrtE dxs PBAD CrtI CrtY Carotenoids crtE crtI crtY Pconst

22. Carotenoid production in cells expressing dxs from a BAC 10.0 8.0 6.0 Cell growth (OD600nm) Lycopene (mg/ml) 4.0 2.0 0.0 0 0.013 0.133 1.33 13.3 Arabinose concentration (mM)

23. Carotenoid production in cells expressing dxs

24. Gene expression tools for metabolic engineering Reproducible promoter control

25. The arabinose-inducible PBAD promoter PC Chromosome Plasmid ParaE araC araE gfp PBAD inside outside

26. The arabinose-inducible PBAD promoter Plasmid arabinose Chromosome PBAD ParaE gfp araE A A A A araC PC Green Fluorescent Protein inside outside arabinose

27. Expression of gfp from the arabinose-inducible promoter 100000 10000 Fluorescence/OD600 1000 100 0.00001 0.0001 0.001 0.01 0.1 1 10 Arabinose (wt %)

28. Varying gene expression levels by varying induction in individual cells Average gene expression Inducer concentration

29. Varying gene expression levels by varying the number of induced cells Average gene expression Inducer concentration

30. Flow cytometric analysis Laser FALS sensor Frequency Fluorescence detector Fluorescence

31. Frequency Frequency Frequency Fluorescence Fluorescence Fluorescence Varying gene expression levels by varying the number of induced cells

32. Frequency Frequency Frequency Fluorescence Fluorescence Fluorescence Varying gene expression levels by varying induction in individual cells

33. Native arabinose-inducible system gives rise to two populations Increasing inducer concentration Fluorescence intensity

34. All-or-None Pathway Control Pyruvate Pyruvate IPP DMAPP IPP DMAPP GPP GPP FPP FPP Amorphadiene Amorphadiene Artemisinin Artemisinin

35. arabinose arabinose arabinose The arabinose-inducible PBAD promoter arabinose PBAD gfp Pcon araE PC araC GFP inside outside arabinose

36. Population analysis of engineerined E. coli expressing gfp Increasing inducer concentration Fluorescence intensity

37. Regulated Pathway Control Pyruvate Pyruvate IPP DMAPP IPP DMAPP GPP GPP FPP FPP Amorphadiene Amorphadiene Artemisinin Artemisinin

38. Gene expression tools for metabolic engineering Expression of multiple genes

39. gene 3 gene 2 gene 4 gene 1 Balancing enzymatic reactions in the cell A Enzyme 4 Enzyme 1 X Enzyme 3 Z Y1 B Enzyme 2 Y2 C

40. P1 P4 P3 gene 3 gene 2 gene 4 gene 1 P2 Using individual control elements A Enzyme 4 Enzyme 1 X Enzyme 3 Z Y1 B Enzyme 2 Y2 C

41. gene 3 gene 2 gene 4 gene 1 Synthetic operons P DNA mRNA A Enzyme 4 Enzyme 1 X Enzyme 3 Z Y1 B Enzyme 2 Y2 C

42. RNase mRNA A Enzyme 1 Enzyme 3 Enzyme 4 X Y1 Z B Enzyme 2 Y2 C

43. Secondary structures in the mRNA protect natural mRNAs against nucleases ribosome RBS exonuclease RNase E endonuclease

44. ggagtcgacttatctcgagtgagatattgttgacggtaccccg cctcagctgaatagagctcactctataacaactgccatggggc Sal I Asp718 a g g u c g u a c g u a a u u a u u u c g a u g u g c u a g c gguaccguauuuuggaugauaacgaggcgcaaaaaug c a A cassette system to design mRNA stability tccatacgtcgacggtaccgtattttggatgataacgaggcgcaaaaaatg aggtatgcagctgccatggcataaaacctactattgctccgcgttttttac Asp718 Sal I lacZ Insertion of hairpin cassette tccatacgtcgacttatctcgagtgagatattgttgacggtaccgtattttggatgataacgaggcgcaaaaaatg aggtatgcagctgaatagagctcactctataacaactgccatggcataaaacctactattgctccgcgttttttac Transcription

45. pHP17 pHP8 pHP16 pHP9 a g u a g g u c g pHP14 u a c g a g t1/2 = 6.1 min g u a u pHP4 g c c g a u a u u a g pHP15 c c g u a u a g c a u u a u a t1/2 = 19.8 min u g u u u t1/2 = 5.5 min u a c g pHP10 g c a u g u g c g c u a u a u c g g c gguaccguauuuu u a c t1/2 = 12.5 min t1/2 = 4.9 min a a u u a u u u c g a u g u g c t1/2 = 8.3 min t1/2 = 2.1 min u a pTC40 g c gguaccguauuuu c a a g g a u g g acgucgacagguaccguauuuu u a g u g c g c u c t1/2 = 6.8 min c g u u a a t1/2 = 2.6 min u c g a c a c g u u u a a a a u u u u a u a a u c g c g a u a g u u g g u c g c u a u a g c g gguaccguauuuu c c a gguaccguauuuu c a a c g g u u u c c a a g a a t g a g c u a g c g c g u a u a a u c g u a u u a u u c g c g u a a u a u u a g u u a u g c u u a u u a u g c c c g g gguaccguauuuu c a a u u a g g u u u a u g g c c u u a u a c g g g c c a u gguaccguauuuu gguaccguauuuu c c g u a a g c u a g c gguaccguauuuu c a A family of synthetic hairpins

46. A synthetic operon for carotenoid production CrtE CrtI CrtY Phytoene Lycopene b-Carotene HPx HP crtY crtI p70yHPxi 3' RNase E site

47. HP16 HP crtY crtI 5' 3' 5' 3' 5' 3' CrtE CrtI CrtY Phytoene Lycopene b-Carotene

48. Variation in hairpins RNase E site crtY crtI 5' p70yi 3' HP17 crtY crtI 5' p70yHP17i 3' HP4 crtY crtI 5' p70yHP4i 3' HP16 crtY crtI 5' p70yHP16i 3'

49. 400 300 -carotene/lycopene 200 100 b 0 p70yi p70yHP4i p70yHP16i p70yHP17i Relative levels of carotenoids CrtE CrtI CrtY Phytoene Lycopene b-Carotene

50. Clone the genes Synthesis of artemisinin in cells Artem. FPP