1 / 28

CS 6990 Bioinformatics

CS 6990 Bioinformatics. Fall 2004 Dr. Susan Bridges. DNA, RNA, and Protein. Central Dogma of Molecular Biology. Transcription. Translation. Replication. DNA. RNA. Protein. Reverse Transcription. DNA. Base Pairs (bp). A, G Purines C, T Pyrimidines. Base Pairs in Detail.

haven
Télécharger la présentation

CS 6990 Bioinformatics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. CS 6990Bioinformatics Fall 2004 Dr. Susan Bridges Department of Computer Science and Engineering Bioinformatics

  2. DNA, RNA, and Protein Department of Computer Science and Engineering Bioinformatics

  3. Central Dogma of Molecular Biology Transcription Translation Replication DNA RNA Protein Reverse Transcription Department of Computer Science and Engineering Bioinformatics

  4. DNA Department of Computer Science and Engineering Bioinformatics

  5. Base Pairs (bp) A, G Purines C, T Pyrimidines Department of Computer Science and Engineering Bioinformatics

  6. Base Pairs in Detail Department of Computer Science and Engineering Bioinformatics

  7. String Representation 5’ ……. TACTGAGGC 3’ 3’ ……. 5’ Department of Computer Science and Engineering Bioinformatics

  8. Department of Computer Science and Engineering Bioinformatics

  9. Department of Computer Science and Engineering Bioinformatics

  10. How RNA differs from DNA • Sugar is ribose rather than deoxyribose • Thymine (T) replaced by uracil (U) • Does not typically form a double helix • Performs many functions

  11. Nucleotide Codes Department of Computer Science and Engineering Bioinformatics

  12. Biology Terms • Prokaryotes: • “Primitive” organisms that do not have a nuclear membrane • Includes the bacteria • Eukaryotes: • “Higher” organisms in which the genetic material is localized in the nucleus of the cells. • Includes plants and animals like yeast, corn, protozoa, humans Department of Computer Science and Engineering Bioinformatics

  13. Protein • The most “active” molecules in organisms are proteins • Structural • Enzymes • Proteins are polymers of amino acids—a long string of amino acid residues • 20 amino acids (+ a few strange ones that occur occasionally) Department of Computer Science and Engineering Bioinformatics

  14. Department of Computer Science and Engineering Bioinformatics

  15. Protein Backbone • Backbone • N-terminus (N-terminal) (amino group) • C-terminus (C-terminal) (carboxyl group) Department of Computer Science and Engineering Bioinformatics

  16. Department of Computer Science and Engineering Bioinformatics

  17. Genes and the Genetic Code • Each chromosome is a long chain of DNA • Certain sequences on the chromosome contain the code for a protein. These are called genes. • A gene is composed of a sequence of codons • A codon is a nucleotide triplet (3 base sequence) • The first triplet in a gene is a special codon called the start codon (usually AUG) • The gene ends with a stop codon. • The genetic codeconsists of the 3 letter codes for each amino acid. Department of Computer Science and Engineering Bioinformatics

  18. Features of the Genetic Code • Written in linear form in terms of sequences of bases. • Each “word” in the code is a sequence of 3 bases. • The code is degenerate: most amino acids can be specified by more than one codon. • The code contains start and stop signals but no internal punctuation (commaless). • The code is non-overlapping (codons are read in a single reading frame.) • The code is nearly universal. Department of Computer Science and Engineering Bioinformatics

  19. Analogy Acoapzzcordkathedogatetheratpercliosidklancocoaiem ifuzzclqzthecatandthehatareredpercopoqpooijcc9a8cjkal;cackcccjasoeuejlschjw8eicnxkdoaoejknthecrivhejelpauenvypzznccmqthecowranforthedogandthecatandthedogatepercxqoicqickvperyerlcaperkcaeiakd Department of Computer Science and Engineering Bioinformatics

  20. Messenger RNA has Copy of Message from DNA Department of Computer Science and Engineering Bioinformatics

  21. met arg val Flow of Genetic Information Gene DNA template strand (antisense) T A C G G C C A A transcription Messenger RNA (mRNA) A U G C C G G U U Translation on ribosomes protein Department of Computer Science and Engineering Bioinformatics

  22. More terminology • Promoter sequence sometimes used to recognize start of strand • DNA has 2 strands • Coding strand (sense): looks like mRNA • Template strand (anticoding or antisense): transcribed • DNA is “read” from the 3’ end to 5’ end to make mRNA • mRNA is built from 5’ to 3’ • Upstream—before the start of the gene • Downstream—after the end of the gene Department of Computer Science and Engineering Bioinformatics

  23. RNA synthesis 2 complementary DNA strands 5’ ATGCCGTTAGACCGTTAGCGGACC 3’ TACGGCAATCTGGCAATCGCCTGG Coding strand Template strand 5’ AUGCCGUUAGACCGUUAGCGGACC RNA Department of Computer Science and Engineering Bioinformatics

  24. Each gene in most eukaryotes is divided into coding sections (exons) and noncoding sections (introns). Introns are spliced out or mRNA. Only exons used to build protein Department of Computer Science and Engineering Bioinformatics

  25. Department of Computer Science and Engineering Bioinformatics

  26. Department of Computer Science and Engineering Bioinformatics

  27. Web References • Access Excellence Graphics Gallery, http://www.accessexcellence.org/AB/GG/ • http://bioinfo.mbb.yale.edu/course/classes/c2/ppframe.htm • http://cmgm.stanford.edu/biochem218/01Representation.html • http://www.math.tau.ac.il/~rshamir/algmb/01/algmb01.html • http://www.hgmp.mrc.ac.uk/GenomeWeb/docs-bioinformatics.html Department of Computer Science and Engineering Bioinformatics

More Related