hide
Uploaded by
24 SLIDES
381 VUES
240LIKES

E-COOL-I

DESCRIPTION

This project aims to genetically modify E. coli to fluoresce red at low temperatures (37°C) in the presence of chlorine. We will identify the optimal temperature and chlorine concentration for fluorescence. Furthermore, as a backup, we will explore the expression of high-temperature fluorescence using a different gene from coral. The methodology includes isolation of plasmids, digestion, ligation of BioBrick parts, and evaluation under varying environmental conditions. Successful transformation and fluorescence detection will be confirmed through gel electrophoresis.

1 / 24

Télécharger la présentation

E-COOL-I

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. E-COOL-I Tina Khoury Jeremy Gerbig Derek Blanchard Kerwin Dunham

  2. Original Goals • Achieve • E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts). • Find optimum temp where color change will be found. • ~ 30-37°C • Find optimum concentration of Cl. • Gene originally from coral. • Backup Plan • Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. • Expressing high (green) and low (red) temp. genes in one sequence.

  3. Project’s Original Protocol • Isolate plasmid • Digest with appropriate enzymes. • Confirm base pair length • Ligation of confirmed digested Biobrick parts • Ligate final Biobrick arrangement • Confirm arrangement and biobrick standards • Grow under different environmental conditions

  4. Protocol • Isolate biobricks out of well Plates. • BBa_I12007 – Promoter • Created oligo - RBS • BBa_E1010 - Gene • BBa_B0015 - Double Terminator

  5. How It Was Suppose To Be Done? • Part 1 • BBa_I12007 • 82Bp • Promoter: modified lambda Prm Promoter • (OR-3 obliterated) • 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3 • gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt

  6. How It Was Suppose To Be Done? • Part 3 Gene • Spring 2008 Distribution Source Plate 1002 1D pSB1A2 • 3 BBa_E1010 • 681Bp • Gene: highly engineered mutant of red fluorescent protein from Discosomastriata (coral) • 2010 Kit Plate 1 Well 18F, pSB2K3 • atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

  7. How It Was Suppose To Be Done? • Part 4 & 5 Super Part BBa_B0015 • BBa_B0010 doubleT • 129 Bp • Stop, T1 from E. coli rrn B • (Transcriptional Terminator) • 2010 Kit Plate 1 Well 13D, pSB1A2 • BBa_B0012 • Stop, TE from coliophage T7 • (Transcriptional Terminator) • Source Plate 1000 Well 1B, pSB1A2 • ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

  8. Design & Construction of Oligo’s • Part 2 • RBS to small

  9. Protocol Cont. • Transform the bacteria. • Grow the transformed bacteria. • Isolate & check plasmids. • Gel Electrophoresis

  10. Ligation of Parts • The complete complex Biobricks sequence! • Combine 3 parts • BBa_I12007 – Promoter • Created Oligo- RBS • BBa_E1010 - Gene • BBa_B0015 - Double Terminator

  11. Protocol cont… • Combining biobrick parts by digestion & ligation. • BBa_I12007 - Promoter • BBa_I13503 - RBS + Gene • BBa_B0015 - Double Terminator S X & P X & P

  12. Protocol cont… • Combining biobrick parts by digestion & ligation. • BBa_I12007 –Promoter + • Created oligo- RBS • BBa_E1010 Gene • BBa_B0015 - Double Terminator E & S X & P S

  13. Mini-Prep

  14. Digestion & Gel Electrophoresis MasterMix

  15. Ligations • 10x ligation Buffer 2ul • T4DNA ligase 2ul • Gene 1ul • Double Terminator 5ul • H2O 5ul • Incubate room temp. 1hour • Store at 4℃

  16. Bacterial Transformation Results • Growth After Plating

  17. Isolating of Parts 1st Digestion & Gel • Our digestion was successful a band of 681 was our target for the Gene Latter 13,12,11,10,9,8,7,6,5, 4, 3,2 1,latter • 100bp • 250bp • 500bp • 750bp • 1000bp • 100bp • 250bp • 500bp • 750bp • 1000bp Gene BBa_E1010 Isolation

  18. Isolating of Parts 10/12 Expected • Promoter –82bp • Double terminator-129bp • RBS was not ran due to size of only 13bp • 100bp • 250bp • 500bp • 750bp • 1000bp Ladder 1,2, 3,4 5,6,7 Double Terminator Promoter (BBa_B0015) (BBa_I12007) Double Terminator--Promoter

  19. Redigestion of Gene 10/19 • Expected Gene 681 Bp • 1st cut Spe1 Xbal • Redigested • Spe1 EcoR1 • 100bp • 250bp • 500bp • 750bp • 1000bp • 1,2,3 • Gene

  20. Ligation Results 11/11 (Promoter & RBS) (Gene & DT) • Ligation problem possibly low functioning EcoR1 • Promoter & RBS – not sure if ligated correctly due to RBS small size 13bp. Difference can’t be seen on gel • Gene & DT – Believe only DT is showing up 129bp 15,14,13,12,11,10,9,8,7,6 5,4,3,2,1 ladder • 1000bp • 750bp • 500bp • 250bp • 100bp

  21. Results 11/16 • We Concluded that EcoR1 was not fully functional. • So our parts were not cut open properly to ligate the Gene to the double terminator. 9,8,7,6,5,4,3, 2 1 ladder • 1000bp • 750bp • 500bp • 250bp • 100bp Attempted Gene & Double Terminator Ligation

  22. Final Disappointment New Religation of stored Gene & Double Terminator • No proper digestions around 810bp. • No Ligation? • Error Analysis: • Still low functioning enzymes & Resuspension fluid had been left out of 4C for undisclosed amount of time. 15,14,13,12,11,10,9,8,7,6,5,4,3,2,1 ladder • 100bp • 250bp • 500bp • 750bp • 1000bp Attempted Gene & Double Terminator Ligation

  23. Conclusion We were successful in isolating and confirming 3 of our Biobrick parts. Gene Promoter Double terminator. Given more time, fresh enzymes and other properly working materials ligating of our biobrick parts would have been successful.

  24. References • Openwetware.org • Partsregistry.org • http://filebox.vt.edu/.../biol_4684/Methods/genes.html • http://www.fasebj.org/content/vol20/issue14/images/large/z386120661480003.jpeg • http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mga&part=A1549 • http://www.stat.berkeley.edu/users/terry/Classes/s260.1998/Week8b/week8b/node3.html • http://www.biotechlearn.org.nz/var/biotechlearn/storage/images/themes/from_genes_to_genomes/images/bacterial_transformation/4063-1-eng-AU/bacterial_transformation_large.jpg

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer