holden
Uploaded by
48 SLIDES
1077 VUES
540LIKES

Human Genetics

DESCRIPTION

Human Genetics. Weibin Shi Michele Sale. Contact Information. Shi: ws4v@virginia.edu ; 243-9420 Sale: ms5fe@Virginia.EDU ; 982-0368 . Recommended textbooks. Medical Genetics -Jorde, Carey, Bamshad & White Mosby, ISBN 13: 978-0-323-04035-8 Human Molecular Genetics - Strachan T, Read A

1 / 48

Télécharger la présentation

Human Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Human Genetics Weibin Shi Michele Sale

  2. Contact Information • Shi: ws4v@virginia.edu; 243-9420 • Sale: ms5fe@Virginia.EDU; 982-0368

  3. Recommended textbooks • Medical Genetics -Jorde, Carey, Bamshad & White • Mosby, ISBN 13: 978-0-323-04035-8 • Human Molecular Genetics - Strachan T, Read A Garland Science,ISBN-10: 0815341822

  4. Overview of course content • 1: Organization of the human genome • 2: Genetic variation • 3. Patterns of inheritance • 4: Population genetics • 5: linkage disequilibrium • 6: Genetic epidemiology • 7: Applied research in human genetics

  5. Organization of the human genome

  6. Human genome sequence published - February 2001

  7. Genes are found in the nucleus and mitochondria

  8. Nuclear genome packaged with proteins to form chromatin

  9. Human chromosomes 23 pairs 46 chromosomes 22 pairs – autosomes 1 pair sex chromosomes 46,XY Normal male

  10. Human chromosomes 46,XX Normal female

  11. A little more basic terminology

  12. Human genome = nuclear genome + mitochondrial genome

  13. Mitochondrial genome 16,569 bp 37 genes NUCLEAR GENOME 24 distinct chromosomes (22 autosomal + X + Y) 3,200 Mbp 25,000 genes

  14. Human Mitochondrial Genome Small (16.5 kb) circular DNA rRNA, tRNA and protein encoding genes (37) 1 gene/0.45 kb Very few repeats No introns 93% coding Genes are transcribed as multimeric transcripts Maternal inheritance

  15. What are the mitochondrial genes? • 24 of 37genes are RNA coding • 22 tRNA • 2 ribosomal RNA (23S, 16S) • 13 of 37 genes are protein coding some subunits of respiratory complexes and oxidative phosphorylation enzymes

  16. Limited autonomy of mitochondrial genome mt encoded nuclear NADH dehydrogenase 7 subunits 35 subunits Cytochrome b-c1 comp 1 subunit 10 subunits Cytochrome C oxidase 3 subunits 10 subunits ATP synthase complex 2 subunits 14 subunits

  17. Two overlapping genes encoded by same strand of mt DNA (unique example) Two independent ATG located in Frame-shift to each other, second stop codon is derived from TA + A (from poly-A)

  18. Mitochondrial codon table

  19. Human Nuclear Genome 3,200 Mb 23 (XX) or 24 (XY) linear chromosomes 25,000 genes 1 gene/120kb Introns in the most of the genes 1.5 % of DNA is coding Genes are transcribed individually Repetitive DNA sequences (45%) Inherited from both parents

  20. Human Nuclear Genome In human nuclear genome gene-rich regions are separated by gene deserts Chr. 19 has the highest gene density Chr. 13 & Y show the lowest gene density

  21. Human genome base content • 41% CG in average 38% CG for Chr. 4 and Chr. 13 49% for Chr. 19 • Regions with wide swings in CG content (e.g. from 33.1% to 59.3%) Gene density correlates with higher CG content

  22. CpG dinucleotide depletion • Expected frequency is 4.2% • Observed frequency is five times lower

  23. Location of CpG islands in the gene CpG islands in the regulatory areas of human genes

  24. Human nuclear genome • Gene density varies widely • Averagely 9 exons per gene • 363 exons in titin gene • Certain genes are intronsless • Largest intron is 800 kb (WWOX gene) • Smallest introns – 10 bp • Average 5’ UTR 0.2-0.3 kb • Average 3’ UTR 0.77 kb • Largest protein: titin: 38,138 aa

  25. Gene density varies substantially between chromosomal regions

  26. Genes vary in size and exon content

  27. INTRONLESS GENES • Interferon genes • Histone genes • Many ribonuclease genes • Heat shock protein genes • Many G-protein coupled receptors • Various neurotransmitters receptors and hormone receptors

  28. Genes within genes

  29. Classical gene families: members exhibit a high degree of sequence similarity CS = chorionic somatomammotropin four placenta-specific genes, primates only serum albumin alpha-albumin vitamin D-binding protein

  30. Gene families: gene products bearing short conservative amino acid motifs DEAD box proteins are involved in mRNA splicing and translation initiation; DEAD box (Asp-Glu-Ala-Asp) WD proteins take part in a variety of regulatory functions, GH (Gly-His) should be at 23-41 aa distance from WD (Trp-Aps)

  31. Gene superfamily: Proteins that are functionally related in a general sense, but show only weak homology

  32. Functionally similar genes are occasionally clustered, but usually dispersed throughout the genome

  33. Non-coding RNA genes • Code for functional RNA • ncRNA represent 98% of all transcripts in a mammalian cell • ncRNA can be: • Structural • Catalytic • Regulatory

  34. How many genes in the nuclear genome? ~3000 RNA genes in the nuclear genome ~10% of human gene count have not been taken into account in gene counts

  35. Non-coding RNA • tRNA – transfer RNA: involved in translation • rRNA – ribosomal RNA: structural component of ribosome, where translation takes place • snoRNA – small nucleolar RNA: functional/catalytic in rRNA maturation • Antisense RNA: gene regulation/silencing

  36. microRNA • A new class of non-coding RNA gene • Products are 19~25 nt RNAs • Precursors are 70-100 nt. • Block translation or result in degradation of target mRNA

  37. Tandem repeats and interspersed repeats

  38. Satellite DNA is repetitive DNA that could be separated by centrifugation Equilibrium density gradient centrifugation Sheared DNA in Cesium Chloride gradient

  39. Satellite DNA Alpha –satellite (Centromere DNA) Microsatellite Minisatellite

  40. Microsatellite di-, tri-, and tetra-nucleotide repeats ~10% of the nuclear genome TGCCACACACACACACACAGC TGCCACACACACA------GC TGCTCATCATCATCAGC TGCTCATCA------GC TGCTCAGTCAGTCAGTCAGGC TGCTCAGTCAG--------GC

  41. Minisatellites • 6-64 bp repeating pattern 1 tgattggtct ctctgccacc gggagatttc cttatttgga ggtgatggag gatttcagga 61 attttttagg aattttttta atggattacg ggattttagg gttctaggat tttaggatta 121 tggtatttta ggatttactt gattttggga ttttaggatt gagggatttt agggtttcag 181 gatttcggga tttcaggatt ttaagttttc ttgattttat gattttaaga ttttaggatt 241 tacttgattt tgggatttta ggattacggg attttagggt ttcaggattt cgggatttca 301 ggattttaag ttttcttgat tttatgattt taagatttta ggatttactt gattttggga 361 ttttaggatt acgggatttt agggtgctca ctatttatag aactttcatg gtttaacata 421 ctgaatataa atgctctgct gctctcgctg atgtcattgt tctcataata cgttcctttg Repeat: AGGAATTTTT

  42. α-Satellite repeat • 171 bp sequence repeat

  43. Interspersed repetitive DNA • SINE (Short interspersed nuclear elements): • Alu, ~0.3 kb, ~10,7% of human DNA (1,200, 000 copies) • MIR, ~0.13 kb, 3% of human DNA (500,000 copies) • LINE (Long interspersed nuclear elements): • ~0.8 kb, ~21% of human DNA (~1,00,000 copies)

  44. Chromosomal location of repeats

  45. Pseudogenes • Non-functional copy of a gene • Non-processed pseudogene • Nonfunctional copies of the genomic DNA sequence of a gene • Contain exons, intron, and flanking sequences • Processed pseudogene • Nonfunctional copies of the exonic sequences of a gene • Reverse-transcribed from an RNA transcript • No 5’ promoter • No introns • Often includes polyA tail • Both include events that make the gene non-functional • Frameshift • Stop codons • Could be as high as 20-30% of all Genomic sequence predictions could be pseudogene • We assume pseudogenes have no function, but we really don’t know!

  46. Human Genome Organization HUMAN GENOME Nuclear genome 3,200 Mb 25,000 genes Mitochondrial genome 16.5 kb 37 genes Genes and gene- related sequences Extragenic DNA Two rRNA genes 22 tRNA genes 13 polypeptide- encoding genes Unique or moderately repetitive Unique or low copy number Moderate to highly repetitive Coding DNA Noncoding DNA Gene fragments Pseudogenes Introns, untranslated sequences, etc. Interspersed repeats Tandemly repeated

More Related