1 / 30

Algorithmic self-assembly for nano-scale fabrication

Algorithmic self-assembly for nano-scale fabrication. Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech. DARPA NSF NASA. Constructing Complex Molecular Objects (Development/Morphogenesis).

hume
Télécharger la présentation

Algorithmic self-assembly for nano-scale fabrication

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA

  2. Constructing Complex Molecular Objects(Development/Morphogenesis) Information specifies a process that creates organization

  3. Algorithmic growth ------------- Few components, large intelligently-organized object. Blueprints, Template ------------- Arbitrary structure. Larger object requires larger template. Periodic crystals ------------- Few components, large homogeneous object. Creating Order

  4. Nadrian Seeman & DNA nanotechnology

  5. Chemical structure of DNA T C A T G C A G

  6. DNA AGTCTTCGAATGCTAATTGCGCT AGCGCAATTAGCATTCGAAGACT single-stranded double-stranded

  7. TAGGCAG CTAATGT TGACCAC ACTGGTG ACTGGTG TGACCAC TAGGCAG CTAATGT GATTACA ATCCGTC ATCCGTC GATTACA Designing DNA molecular complexesNadrian Seeman, 1980’s 

  8. Chen and Seeman, Nature 350, 631 (1991).

  9. Periodic 2-tile crystal (DAO-E lattice) TCACT CATAC 1 2 3 4 TAGAG TCTTG AGAAC ATCTC 3 4 1 2 GTATG AGTGA Winfree, Liu, Wenzler, Seeman, Nature 394: 539-544 (1998)

  10. Self-Assembly of DNA

  11. High resolution AFM imaging Hole = lattice defect Conformation of helix and sticky ends? crystal growth movie Rizal Hariadi, Winfree group

  12. Some variations Winfree, Liu, Wenzler, Seeman, Nature, 1998 LaBean et al, JACS, 2000 Mao, Sun, Seeman, JACS 1999

  13. More variations 1D ribbons Zigzag ribbon Rhombus ribbon Nano-track TX ribbon 2D periodic lattices HJ lattice TX lattice 4x4 lattices Rhombus lattice DX lattice (Mao, Sun & Seeman, 1999) (Park, Yin, Liu, Reif LaBean & Yan 05) (Li, Park, Reif, LaBean, Yan 03) (Schulman, Winfree, 06) … (Malo, Mitchell, Venien-Bryan, Harris,Wille, Sherratt & Turberfield 05) (Winfree, Liu, Wenzler & Seeman 98) (Mao, Sun & Seeman 99) (LaBean, Yan, Kopatsch, Liu, Winfree, Reif, & Seeman 00) (Yan, Park, Finkelstein, Reif & LaBean 03) hexagonal lattice triangle lattice 3 point-star lattices DDX lattice 1D tubes symmetry lattice Chiral DX tube 4x4 tube TX-tube DX tube (Chelyapov, Brun, Gopalkrishnan, Reishus, Shaw & Adleman 04) (Liu, Wang, Deng, Walulu & Mao 04) (Reishus, Shaw, Brun, Chelyapov & Adleman 05) (He, Chen, Liu, Ribbe & Mao 05) (He, Tian, Chen, Deng, Ribbe & Mao 05) (Rothemund, Ekani-Nkodo, Papadakis, Kumar, Fygenson & Winfree 04) (Mitchell, Harris, Malo, Bath &Turberfield 04) (Yan, Park, Finkelstein, Reif & LaBean 03) (Liu, Park, Reif & LaBean 04) SAO lattice single-strand DX-like tubes 3-helix bundle 6-helix bundle … … (Rothemund 05) (Mathieu, Liao, Kopatsch, Wang, Mao & Seeman 05) (Park, Barish, Li, Reif, Finkelstein,Yan & LaBean 05) (He, Chen, Liu, Ribbe & Mao 05)

  14. DNA computing Len Adleman:DNA self-assembly is programmable Adleman, Science (1994)

  15. 0 0 1 0 1 0 1 0 1 0 0 0 0 0 0 0 1 1 0 0 1 1 0 0 0 0 0 0 each new number is the sum of the two below it 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 The Sierpinski Triangle(aka Pascal’s Triangle mod 2) 0 Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

  16. The Sierpinski Triangle(aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

  17. The Sierpinski Triangle(aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

  18. DAO-E Sierpinski Tile Set decorrelation movie powers of two movie

  19. Making the boundary (the input string) 750 nm 25 nm }

  20. Algorithmic crystals errors during assembly algorithmic growth scaffold strand decorrelation movie DAO-E Sierpinski experiments 1.6 um scan

  21. DAO-E Sierpinski triangle experiments Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2: e424 (2004) 340nm

  22. Scaffolded DNA origami

  23. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

  24. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

  25. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

  26. Scaffolded DNA origami

  27. Scaffolded DNA origami

  28. Scaffolded DNA origami

  29. Algorithmic growth ------------- Few components, large intelligently-organized object. Blueprints, Template ------------- Arbitrary structure. Larger object requires larger template. Periodic crystals ------------- Few components, large homogeneous object. Creating Order

More Related