hye
Uploaded by
10 SLIDES
384 VUES
130LIKES

TELOMERES

DESCRIPTION

Dr. José María Romero Romero. TELOMERES. TELOMERES. TELOMERES:. are specialized structures at the end of all eukaryotic chromosomes. ensure chromosome stability and protect the ends from degradation and from fusing with other chromosomes.

1 / 10

Télécharger la présentation

TELOMERES

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Dr. José María Romero Romero TELOMERES

  2. TELOMERES TELOMERES: • are specialized structures at the end of all eukaryotic chromosomes. • ensure chromosome stability and protect the ends from degradation and from fusing with other chromosomes. • contain longthy streches of non-coding tandemly repeated sequence, (TTAGGG)n, and specific proteins.

  3. TELOMERES • Normal somatic cells lose telomeric repeats with ongoing cell division. • Telomere length is quite important for cells because they work as a buffer avoiding the loss of coding DNA.

  4. TELOMERES • The loss of telomeric repeats triggers replicative senescense in cells. • Telomeres sequences are extraordinary highly conserved in evolution: all vertebrates have the same simple sequence repeat.

  5. TELOMERES • There is an important enzyme: TELOMERASE, active only in embryonic, proliferatice cells of renewal tissues, adult male germline and cancer cells, that is the main regulator of telomere´s length. • TELOMERASE is a reverse transcriptase ( a RNA-dependent polymerase) that contains an RNA with the sequence complementary to the telomere repeat TTAGGG. RNA´s polymerase is used as the template.

  6. TELOMERES • The model for telomeres is that they are the physical ends of linear eukaryotic chromosomes that contain up to 15 Kb of non-coding tandemly repeated sequence: (TTAGGG)n, and specific proteins, and an overhang of 50- 200 nucleotides in the chromosome terminus.

  7. TELOMERES Old model of a human telomere DNA Chromosome DNA tandem repeat - (TTAGGG)n 3’ 5’ 30-200 nt (3´overhang) 5-15kb

  8. TELOMERES New model of a human telomere T- LOOP D-LOOP 5´ 5´ TTAGGGTTAGGGTTAGGGTTA 3´ AATCCCAATCCCAA TCCCAAT 3´overhang,•200 nt

  9. TELOMERES During senescense most overhang drop below 100 nt, potencially disrupting the T-loop or another telomeric structure. This telomere structure hasn´t stability D-LOOP 5´ 5´ TTAGGGTT 3´ AATCCCAATCCCAA TCCCAAT 3´overhang, •100 nt

  10. TELOMERES 3´overhang erosion seems to be a direct result of continued cellular division and not of the senescense program itself, so when there are about 100 nt ... 5´ 3´ Damaged chromosomes are degraded by nucleases and participate in end joining reactions that fuse two free ends. Chromosomal destabilization is linked to malignancies

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer