1 / 13

DNA Sequencing Techniques and Software Overview

Understand DNA sequencing jargon, use Chromas and Staden Suite software for sequence analysis, assembly, and editing. Practice with trace data and produce finished sequence files.

iago
Télécharger la présentation

DNA Sequencing Techniques and Software Overview

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Rui Pires MartinsPhD Candidate, CMMG M B G 8 6 8 0 computer applications in molecular genetics

  2. before we start… • changes to .login file? • created two directories in genetics • “traces” • “class” (or something??) • transferred a copy of files to “class” • by wsFTP or through Windows Mgb8680 | DNA sequencing

  3. outline • DNA sequencing • chromatogram/trace data • chromas v.1.45 • staden suite • preGAP4 • GAP4 • trev • spin Mgb8680 | DNA sequencing

  4. DNA sequencing jargon • read a DNA sequence • trace a chromatographic representation of DNA sequencing data • contiguous sequence several reads with common spans joined together • consensus the resulting sequence from several contigs that overlap • template “sense” strand • complement“anti-sense” strand 5’ ATTGGAGATCCGACTAATCCA 3’ 3’ TAACCTCTAGGCTGATTAGGT 5’ Mgb8680 | DNA sequencing

  5. DNA sequencing AGTC TCAG Mgb8680 | DNA sequencing

  6. fluorescent DNA sequencing Mgb8680 | DNA sequencing

  7. each nucleotide is colour coded “good” sequence reads have well-defined peaks sequence traces Mgb8680 | DNA sequencing

  8. sequence traces A A T T A T G T A A A T T • “bad” sequence isn’t so pretty and requires some practise to learn to “call” • if two peaks overlap, largest peaks “wins”, unless the peak encompasses more than one residue • “bad” sequence REQUIRES CONFIRMATION Mgb8680 | DNA sequencing

  9. Chromas v.1.45 • basic chromatogram/trace reading/viewing programme for ab1 and scf files • freeware, works in Windows environments • some limited editing capabilities • examples: forward.ab1 & reverse.ab1 • Compare to forward.seq and reverse.seq Mgb8680 | DNA sequencing

  10. Staden Suite Mgb8680 | DNA sequencing

  11. Staden suite • very comprehensive suite of programmes for sequence analysis, manipulation and assembly • (was?) free to academics • preGAP4 processes/manipulates raw data prior to assembly • GAP4 (genome assembly) assembles/ manipulates processed reads into contigs; analyzes sequence integrity; organizes sequencing projects • trev trace viewing programme; can be used along GAP or on its own. Mgb8680 | DNA sequencing

  12. Staden suite • examples: lb3.ab1, lb4.ab1, ub3l.ab1, ub3lup.ab1, ub4.ab1, ubml.ab1, ubmup.ab1 • vector file: pBSK+antisense5to3 • you will learn to read these files into preGAP4; process them; then assemble the files into a contig using GAP4. • trev will be used to edit the sequence reads • you will also learn to produce a finished sequence file that could be submitted to GenBank Mgb8680 | DNA sequencing

  13. assignment • Finish the assembly of the 7 files into as long a contig as you can generate. Be sure to edit any sequence ambiguities as you go. Submit a final text file (fastA format) with this sequence. • Repeat the assembly. Only this time, shotgun all 7 files at once. What happened? Are there any advantages to the manual process? (HINT: you’ll have to create a new database in Staden to do this) • Use one of the trace readers/editors to edit the following residues from reverse.ab1 270 280 290 300 GCCCCTACACTCGNNNGCCTGCCCGCCTCTCAA • Assemble the forward.ab1 and reverse.ab1 files into a staden reads database. What is different this time (i.e. do you notice any annotations or tagged regions in the contigs; and if so what?) What advantages can you see to tagging these regions before you try to assemble them? email answers as text to rui@wayne.edu by Sunday night help/questions can also be directed to rui@wayne.edu or through MSN messenger (mutatethis@hotmail.com) Mgb8680 | DNA sequencing

More Related