inara
Uploaded by
84 SLIDES
1215 VUES
840LIKES

DNA

DESCRIPTION

DNA. The basis for genetic inheritance and protein synthesis. Proteins. James Watson and Francis Crick. Developed the double helix model of the structure of DNA in 1953 Received a Nobel Prize along with Maurice Wilkins

1 / 84

Download Presentation
Télécharger la présentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA The basis for genetic inheritance and protein synthesis Proteins

  2. James Watson and Francis Crick • Developed the double helix model of the structure of DNA in 1953 • Received a Nobel Prize along with Maurice Wilkins • Francis Crick was a British physicist and James Watson was an American biologist

  3. Rosalind Franklin • Her X-ray diffraction images were evidence used to help unravel the mystery of the structure of DNA

  4. The Double Helix

  5. The Structure of DNA Monday 4/2/07: Making Models http://www.dnai.org/a/index.html

  6. Quick Review • Remember back when we learned about the chemistry of life? What are the four types of macromolecules that make up living things? ____________________________________ • In mitosis and meiosis we focused on what happens to chromosomes in cell division, what are the chromosomes made of?___________

  7. Quick Review • Remember back when we learned about the chemistry of life? What are the four types of macromolecules that make up living things? Lipids, Carbohydrates, Proteins, & Nucleic Acids • In mitosis and meiosis we focused on what happens to chromosomes in cell division, what are the chromosomes made of? DNA (a nucleic acid)

  8. K W Know Want to know Learned

  9. K DNA is a nucleic acid It is found in chromosomes It replicates before cell division Structure discovered by Watson and Crick, X-ray crystallography by Rosalind Franklin DNA Technology? Used in forensics W What do you want to learn? How are our traits passed down through DNA? How did we discover DNA? What can we use it for? What lies ahead in the future for DNA Technology? Know Want to know Learned

  10. Nucleotides =

  11. Nucleotides = BUILDING BLOCKS OF NUCLEIC ACIDS, SUCH AS DNA AND RNA

  12. I. Structure of DNA • Double Helix Structure • Repeating subunits called ___________ • Each nucleotide is made of a 5-carbon sugar, phosphate, and a nitrogenous base • In DNA, the sugar is ______________

  13. I. Structure of DNA • Double Helix Structure • Repeating subunits called nucleotides • Each nucleotide is made of a 5-carbon sugar, phosphate, and a nitrogenous base • In DNA, the sugar is deoxyribose

  14. Each 5-carbon sugar is attached to one of four ___________ ________: • Adenine • Guanine • Cytosine • Thymine • Chargaff’s ____ ________ • A always pairs with T • C always pairs with G

  15. Hydrogen Bonds • Each 5-carbon sugar is attached to one of four nitrogenousbases: • Adenine • Guanine • Cytosine • Thymine • Chargaff’s Rule forBase Pairing • A always pairs with T • C always pairs with G

  16. Which of the nitrogenous bases above is not found in DNA? What other molecule can you think of that might have it?

  17. Memory Tools: Pure (Purine) Agua (adenine guanine) Cut (cytosine uracil, thymine) Pie (pyrimidine) • Which of the nitrogenous bases above is not found in DNA? • Uracil • What other molecule can you think of that might have it? • RNA (the other nucleic acid besides DNA)

  18. Practice writing Complimentary strands of DNA: For example, “TAG” would be “ATC” • ATGCGCAAATTTGGGATGCTA • GCGCAATTGTATGTATGCATG • GATGGTCTAGCTAGATATCGC

  19. Practice writing Complimentary strands of DNA: For example, “TAG” would be “ATC” • ATGCGCAAATTTGGGATGCTA TACGCGTTTAAACCCTACGAT • GCGCAATTGTATGTATGCATG CGCGTTAACATACATACGTAC • GATGGTCTAGCTAGATATCGC CTACCAGATCGATCTATAGCG

  20. DNA Replication, Tuesday 4/3 • Notes and video wkst - stamp • Model Making Part Deux: DNA Replication • Turn in questions from model-making part one if you have not already • Model Making Part Deux – questions will be collected tomorrow • Reading Guides Due after break

  21. DNA, Chromosomes, & DNA Replication • Where is DNA located????????? • Prokaryotes = no nucleus, DNA is found _____ _____________________________________ • Eukaryotes = true nucleus, DNA is found ____ _____________________________________ • How long is DNA??????? • In E. coli, _______ (contains 4,639,221 base pairs) • In human cells, over ______ (contains 1000 times as many base pairs as a bacterium)

  22. DNA, Chromosomes, & DNA Replication • Where is DNA located????????? • Prokaryotes = no nucleus, DNA is found free in the cytoplasm usually in one large molecule (one chromosome) • Eukaryotes = true nucleus, DNA is found within the nucleus (many chromosomes) • How long is DNA??????? • In E. coli, 1.6 mm (contains 4,639,221 base pairs) • In human cells, over 1 m (contains 1000 times as many base pairs as a bacterium)

  23. How does all that DNA fit inside the nucleus? ______________________ • Chromatin = DNA tightly coiled around proteins called __________

  24. How does all that DNA fit inside the nucleus? It is tightly coiled! • Chromatin = DNA tightly coiled around proteins called histones

  25. The Big Picture: Before cell division, what takes place and why?

  26. The Big Picture: Before cell division, what takes place and why? DNA replication takes place in order for new cells to have an exact copy of genetic information.

  27. When Watson and Crick discovered the structure of the DNA molecule, they also realized that its structure explains ______ _________________________________ • Each strand of the DNA double helix has all the information needed to reconstruct the other strand by using the ___________ _______________________ • Strands are ______________

  28. When Watson and Crick discovered the structure of the DNA molecule, they also realized that its structure explains how DNA can be easily copied or replicated • Each strand of the DNA double helix has all the information needed to reconstruct the other strand by using the mechanism of base pairing • Strands are complementary

  29. DNA replication = the copying process that occurs before cell division to ensure that __________________________________ During replication, DNA separates into two strands, then produces complementary strands following the rules of base pairing Each strand of the helix of DNA serves as a ____________ for the new strand

  30. DNA replication = the copying process that occurs before cell division to ensure that each cell has a complete set of DNA During replication, DNA separates into two strands, then produces complementary strands following the rules of base pairing Each strand of the helix of DNA serves as a template for the new strand

  31. Fill in the correct number responses: • Start with ____ DNA molecule(s) • After DNA replication there are ____ DNA molecule(s) • These two molecules have one “new” strand and one “old” strand • The new molecules are: similar or exact copies. Circle one

  32. Fill in the correct number responses: • Start with 1 DNA molecule(s) • After DNA replication there are 2 DNA molecule(s) • These two molecules have one “new” strand and one “old” strand • The new molecules are: exact copies.

  33. A series of __________ carry out DNA replication • They “unzip” the molecule – __________ __________________________________ • The principle enzyme in replication is ____ __________________________________ • It joins individual nucleotides to a DNA molecule (a polymer) • It also “proofreads” the new strand to increase the chances of ________________________ ____________________________________

  34. A series of enzymes carry out DNA replication • They “unzip” the molecule – hydrogen bonds are broken and the two strands unwind • The principle enzyme in replication is DNA polymerase • It joins individual nucleotides to a DNA molecule (a polymer) • It also “proofreads” the new strand to increase the chances of making an exact copy of the original

  35. (1) (2) • In prokaryotes (1), replication starts at a ______ _______ and goes in two directions until the whole chromosome is finished • In eukaryotes (2), replication starts at ________ _____________, proceeding in two directions until the chromosome is completely copied • Where replication occurs is called the ___________________________________

  36. (1) (2) • In prokaryotes (1), replication starts at a single points and goes in two directions until the whole chromosome is finished • In eukaryotes (2), replication starts at hundreds of places, proceeding in two directions until the chromosome is completely copied • Where replication occurs is called the replication fork

  37. DNA: Transcription and Translation, Wednesday 4/4/07 • Models parts one and two due on Tuesday, 4/10, after break. There will be a part three that day. Have them checked off today if you are finished already. • Reading Guides will be due on Thursday after break. • Today: notes and continue work on models

  38. Recap • DNA is the basis for _______________ and ________________ • Scientists who made significant contributions to the development of the DNA model include: _______________, ______________, _________________, and __________________. • DNA replication occurs before ____________ and is important because ________________ _____________________________________

  39. Recap • DNA is the basis for genetic inheritance and protein synthesis • Scientists who made significant contributions to the development of the DNA model include: Watson, Crick, Franklin, and Wilkins. • DNA replication occurs before cell division and is important because exact copies of DNA are made and passed on to daughter cells.

  40. Moving from Replication to Transcription and Translation • The structure of the double helix made it easy to understand how DNA can be copied but does not explain ____________________________. • Remember from the chapter on the cell and your organelle essays, that the nucleus is the ______ ____________ and ribosomes are the site for ________________________________. • _______________ and _______________ are the two processes that explain how DNA functions as the control center for the cell and how DNA and ribosomes take part in protein synthesis

  41. Moving from Replication to Transcription and Translation • The structure of the double helix made it easy to understand how DNA can be copied but does not explain how a gene functions. • Remember from the chapter on the cell and your organelle essays, that the nucleus is the “control center” and ribosomes are the site for protein synthesis. • Transcription and translation are the two processes that explain how DNA functions as the control center for the cell and how DNA and ribosomes take part in protein synthesis

  42. Think about how proteins are made in the cell. Remember which organelle controls protein synthesis and which organelle synthesizes proteins. How can you pass the message from one to the other?? There is no e-mail or fax machine in the cell… 

  43. RNA carries the genetic information that codes for protein synthesis from the nucleus to the ribosome. RNA is single stranded and smaller so it fits through the nuclear pores RNA DNA

  44. OVERVIEW OF TRANSRICPTION AND TRANSLATION

  45. OVERVIEW OF TRANSRICPTION AND TRANSLATION

  46. While DNA is crucial to everyday operations in the cell by ______________ ____________, it does not directly _________________________________. • An intermediate, known as ______ manufactures proteins • Order of events: Translation Transcription DNA RNA Proteins (Central dogma of molecular biology)

  47. While DNA is crucial to everyday operations in the cell by directing protein synthesis, it does not directly manufacture proteins. • An intermediate, known as RNA manufactures proteins • Order of events: Translation Transcription DNA RNA Proteins (Central dogma of molecular biology)

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer