inge
Uploaded by
33 SLIDES
418 VUES
330LIKES

Genetic Manipulation and Analysis: Tools and Techniques

DESCRIPTION

This review covers GMOs, vectors, hosts, DNA fingerprinting, sequencing, replicating DNA, gel electrophoresis, and essential tools in genetic research. Explore bioremediation, pharming, applications of DNA fingerprinting, PCR, gel electrophoresis, and more.

1 / 33

Télécharger la présentation

Genetic Manipulation and Analysis: Tools and Techniques

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 10 Review

  2. GMOs Vectors and Hosts DNA Fingerprinting Sequencing and Replicating DNA Gel electrophoresis Tools of the Trade 100 100 100 100 100 100 200 200 200 200 200 200 300 300 300 300 300 300 400 400 400 400 400 400 500 500 500 500 500 500 f i n a l j e o p a r d y

  3. GMOs 100 • What does “GMO” stand for?

  4. GMOs 200 • What is the field that relates biological issues to human conduct and moral judgment?

  5. GMOs 300 • How does the idea of bioremediation fit in with GMOs?

  6. GMOs 400 • What is “Pharming”? How does it relate to GMOs?

  7. GMOs 500 • Name a commercial plant product (whether it was actually sold or popular doesn’t matter) that is a GMO, and state what it did/does.

  8. Vectors and Hosts 100 • The idea of removing genetic material from one organism and combining it with the genetic material of a different organism is referred to as…

  9. Vectors and Hosts 200 • What is the difference between a host and a vector?

  10. Vectors and Hosts 300 • What are our two options for vectors?

  11. Vectors and Hosts 400 • List three characteristics that make a good host.

  12. Vectors and Hosts 500 • Name one human disease mentioned, and compare prior treatments as opposed to new treatments.

  13. DNA Fingerprinting 100 • What is one application / use of DNA Fingerprinting?

  14. DNA Fingerprinting 200 • What are the three parts of the DNA molecule?

  15. DNA Fingerprinting 300 • What are the small pieces of DNA that we compare in DNA fingerprinting called?

  16. DNA Fingerprinting 400 • Whom can we exclude as suspects?

  17. DNA Fingerprinting 500 • In the case of 2 year-old Rochelle, Marcus, you…….

  18. Sequencing and Replicating DNA 100 • Nametheprocess

  19. Sequencing and Replicating DNA 200 • Name the process

  20. Sequencing and Replicating DNA 300 • What are the “ingredients” needed for PCR?

  21. Sequencing and Replicating DNA 400 • What are the “ingredients” needed for the Sanger method?

  22. Sequencing and Replicating DNA 500 • Why does sequencing stop when ddATP, ddGTP, ddTTP, or ddCTP is added?

  23. Gel electrophoresis 100 • What is the goal of gel electrophoresis?

  24. Gel electrophoresis 200 • What charge is DNA? What charge will it move towards in an electrophoresis chamber?

  25. Gel electrophoresis 300 • What material is the gel made of? How does the size of DNA influence its movement?

  26. Gel electrophoresis 400 • What is the carcinogenic chemical that is typically used to stain DNA and needs UV light to be seen?

  27. Gel electrophoresis 500 • What are the variable sized pieces of DNA that are cut with restriction enzymes and are used in gel electrophoresis called?

  28. Tools of the Trade 100 • What enzyme unzips the two strands of DNA? • What can be used in its place?

  29. Tools of the Trade 200 • What is the enzyme that seals pieces of DNA together?

  30. Tools of the Trade 300 • What enzyme makes a piece of complementary DNA from a piece of mRNA?

  31. Tools of the Trade 400 • What is the difference between blunt and sticky ends

  32. Tools of the Trade 500 • How many fragments would this piece of DNA be cut into? • BamHI: G|GATC CCCTAG|G TAGGGATCCTATAGGGATCCGGGGGATCC ATCCCTAGGATATCCCTAGGCCCCCTAGG

  33. FINAL JEOPARDY • How do the sons and daughters relate to “Mom” and “Dad”?

More Related