jontae
Uploaded by
48 SLIDES
657 VUES
500LIKES

Exploring Genetic Engineering: From Bacteria to Human Insulin Production

DESCRIPTION

This comprehensive overview delves into genetic engineering, exploring the manipulation of DNA and the tools required to engineer genes and organisms. It focuses on the role of bacteria, plasmids, and restriction enzymes in genetic engineering. Bacteria, as simple unicellular organisms with diverse genomes, enable rapid gene manipulation. By utilizing plasmids and restriction enzymes, new genes can be inserted into bacteria, leading to the production of essential proteins like human insulin. Dive into the fascinating world of biotechnology and its applications in modern medicine.

1 / 48

Télécharger la présentation

Exploring Genetic Engineering: From Bacteria to Human Insulin Production

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biotechnology(Ch.20)

  2. A Brave New World

  3. human genome3.2 billion bases TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT

  4. Biotechnology today • Genetic Engineering • manipulation of DNA • if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with • this unit is a survey of those tools…

  5. Bacteria • Bacteria review • Unicellular prokaryotes • reproduce by binary fission • rapid growth • generation every ~20 minutes • 108 (100 million) colony overnight! • dominant form of life on Earth • incredibly diverse

  6. Bacterial genome • Single circular chromosome • haploid • naked DNA • no histone proteins • ~4 million base pairs • ~4300 genes • 1/1000 DNA in eukaryote

  7. Plasmids • Small supplemental circles of DNA • 5000 - 20,000 base pairs • self-replicating • carry extra genes • 2-30 genes • genes for antibiotic resistance • can be exchanged between bacteria

  8. transformedbacteria recombinantplasmid gene fromother organism cut DNA How can plasmids help us? plasmid vector • A way to get genes into bacteria easily • insert new gene into plasmid • vectorfor gene delivery • bacteria now expresses new gene • bacteria make new protein + glue DNA

  9. Biotechnology cut DNA cut plasmid DNA ligase gene we want recombinant plasmid insert “gene we want” into plasmid...“glue” together like what? …insulin …HGH …lactase Cut DNA? DNA scissors? • Plasmids used to insert new genes into bacteria

  10. How do we cut DNA? • Restriction enzymes • restriction endonucleases • discovered in 1960s • evolved in bacteria to cut up foreign DNA • “restricted” in the sequences they cut • protection against viruses & other bacteria 

  11. What do you notice about these phrases? palindromes radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog

  12. Restriction enzymes CTG|AATTCCG GACTTAA|GGC • Action of enzyme • cut DNA at specific sequences • restriction site • symmetrical “palindrome” • produces protruding ends • sticky ends • will bind to any complementary DNA • Many different enzymes • EcoRI, HindIII, BamHI, SmaI  CTGAATTCCG GACTTAAGGC 

  13. Discovery of restriction enzymes 1960s | 1978 Werner Arber Daniel Nathans Hamilton O. Smith Restriction enzymes are named for the organism they come from: EcoRI = 1st restriction enzyme found in E. coli

  14. Restriction enzymes GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA • Cut DNA at specific sites • leave “sticky ends” restriction enzyme cut site restriction enzyme cut site

  15. Sticky ends GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA chromosome want to add gene to combinedDNA gene you want • Cut other DNA with same enzymes • leave “sticky ends” on both • can glue DNA together at “sticky ends”

  16. Sticky ends help glue genes together AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA sticky ends stick together cut sites chromosome with new gene added chromosome want to add gene to DNA ligase joins the strands Recombinant DNA molecule isolated gene TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA sticky ends AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATCCATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC cut sites gene you want cut sites

  17. aa aa aa aa aa Why mix genes together? TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATCCATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC aa aa aa aa aa How can bacteria read human DNA? “new” protein from organism ex: human insulin from bacteria • Gene produces protein in different organism or different individual human insulin gene in bacteria bacteria human insulin

  18. The code is universal • Since all living organisms… • use the same DNA • use the same code book • read their genes the same way

  19. Copy (& Read) DNA DNA → RNA → protein → trait • Transformation • insert recombinant plasmid into bacteria • grow recombinant bacteria in agar cultures • bacteria make lots of copies of plasmid • “cloning” the plasmid • production of many copies of inserted gene • production of “new” protein • transformed phenotype

  20. gene fromother organism recombinantplasmid transformedbacteria Grow bacteria…make more harvest (purify)protein plasmid growbacteria + vector

  21. A Movie, Perhaps?

  22. Uses of genetic engineering • Genetically modified organisms (GMO) • enabling plants to produce new proteins • Protect crops from insects: BT corn • corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) • Extend growing season: fishberries • strawberries with an anti-freezing gene from flounder • Improve quality of food: golden rice • rice producing vitamin A improves nutritional value

  23. Green with envy?? Jelly fish “GFP” Transformed vertebrates

  24. Discovery of GFP 1960s- 1970s | 2008 Martin Chalfie Roger Tsien Osamu Shimomura GFP and other fluorescent proteins can be used to let us know when genes are “on” and “off”

  25. Engineered plasmids • Selectable marker • antibiotic resistance gene on plasmid • ampicillin resistance • selecting for successful transformation • successful uptake of recombinant plasmid • Building custom plasmids • restriction enzyme sites • antibiotic resistance genes as a selectable marker EcoRI BamHI HindIII restriction sites plasmid ori ampresistance

  26. Selection for plasmid uptake cloning all bacteria grow only transformedbacteria grow • Antibiotic becomes a selecting agent • only bacteria with the plasmid will grow on antibiotic (ampicillin) plate a a a a a a a a a a a a a a a a a LB plate LB/amp plate

  27. X Need to screen plasmids lactose → blue color lactose → white color insertedgeneof interest brokenLacZ gene recombinantplasmid amp resistance • Need to make sure bacteria have recombinant plasmid restriction sites EcoRI all in LacZ gene BamHI HindIII LacZ gene plasmid amp resistance origin ofreplication

  28. Screening for recombinant plasmid • Bacteria take up plasmid • Functional LacZ gene • Bacteria make blue color • Bacteria take up recombinant plasmid • Non-functional LacZ gene • Bacteria stay white color How could you screen for recombinant plasmid using pGLO

  29. Finding your gene of interest G A T C A G T A G • DNA hybridization • find sequence of DNA using a labeledprobe • short, single stranded DNA molecule • complementary to part of gene of interest • labeled with radioactive P32 or fluorescent dye • heat treat DNA in gel • unwinds (denatures) strands • wash gel with probe • probe hybridizes with denatured DNA labeled probe genomic DNA C T A G T C A T C

  30. DNA libraries • Cut up all of nuclear DNA from many cells of an organism • restriction enzyme • Clone all fragments into many plasmids at same time • “shotgun” cloning • Create a stored collection of DNA fragments • petri dish has a collection of all DNA fragments from the organism

  31. 1 2 3 4 Making a DNA library clone plasmids into bacteria all DNA from many cells of an organism is cut with restriction enzymes all DNA fragments inserted into many plasmids engineered plasmid with selectable marker & screening system gene of interest

  32. DNA library recombinant plasmids inserted into bacteria DNA Libraryplate of bacterial colonies storing & copying all genes from an organism (ex. human) But howdo we findcolony with our gene of interestin it? gene of interest ?

  33. Find your gene in DNA library • Locate Gene of Interest • to find your gene you need some of gene’s sequence • if you know sequence of protein… • can “guess” part of DNA sequence • “back translate” protein to DNA ?

  34. 1 3 4 2 Colony Blots Cloning - plate with bacterial colonies carrying recombinant plasmids • Replicate plate • press filter paper onto plate to take sample of cells from every colony • Locate • expose film • locate colony on plate from film Hybridization - heat filter paper to denature DNA - wash filter paper with radioactive probe which will only attach to gene of interest plate plate + filter film filter

  35. Problems… introns • Human Genome library • are there only genes in there? • nope! a lot of junk! • human genomic library has more “junk” than genes in it • Clean up the junk! • if you want to clone a human gene into bacteria, you can’t have…

  36. How do you clean up the junk? • Don’t start with DNA… • Use mRNA • copy of the gene without the junk! • But in the end, you need DNA to clone into plasmid… • How do you go from RNA → DNA? • reverse transcriptase from RNA viruses • retroviruses reverse transcriptase

  37. cDNA (copy DNA) libraries • Collection of only the coding sequences of expressed genes • extract mRNA from cells • reverse transcriptase • RNA → DNA • from retroviruses • clone into plasmid • Applications • need edited DNA for expression in bacteria • human insulin

  38. Where do we go next…. reverse transcriptase trait RNA DNA protein extract mRNA from cells mRNA = active genes How do you match mRNA back to DNA in cells??? • When a gene is turned on, it creates a trait • want to know what gene is being expressed

  39. Microarrays mRNA from cells mRNA → cDNA slide with spots of DNA each spot = 1 gene • Create a slide with a sample of each gene from the organism • each spot is one gene • Convert mRNA → labeled cDNA reverse transcriptase

  40. Microarrays mRNA → cDNA cDNA matched to genomic DNA slide with spots of DNA each spot = 1 gene • Labeled cDNA hybridizes with DNA on slide • each yellow spot = gene matched to mRNA • each yellow spot = expressed gene

  41. Application of Microarrays “DNA Chip” 2-color fluorescent tagging • Comparing treatments or conditions = Measuring change in gene expression • sick vs. healthy; cancer vs. normal cells • before vs. after treatment with drug • different stages in development • Color coding: label each condition with different color • red = gene expression in one sample • green = gene expression in other sample • yellow = gene expression in both samples • black = no or low expression in both

  42. Cut, Paste, Copy, Find… • Word processing metaphor… • cut • restriction enzymes • paste • ligase • copy • plasmids • bacterial transformation • is there an easier way??

  43. I may be very selective… But still Ask Questions! EcoRI BamHI HindIII restriction sites plasmid ori ampresistance

  44. 1. The principal problem with inserting an unmodified mammalian gene into the bacterial chromosome, and then getting that gene expressed, is that • prokaryotes use a different genetic code from that of eukaryotes. • bacteria translate polycistronic messages only. • bacteria cannot remove eukaryotic introns. • bacterial RNA polymerase cannot make RNA complementary to mammalian DNA. • bacterial DNA is not found in a membrane-enclosed nucleus and is therefore incompatible with mammalian DNA.

  45. What is the purpose of a screening gene in a plasmid? • To enable tranformation. • To enable recovery of the plasmid from solution. • To enable identification of successful transformants. • To disable the spread of GE organisms outside of the laboratory • To make the engineered protein product.

  46. 3. Which of the following is true of restriction enzymes? • They are capable of cutting DNA into fragments at specific points in the nucleotide sequence. • They form bonds between DNA fragments • They are used in cell recognition • They are a viral defense against infection by bacteria • They are found in fungi

  47. 4. Which of the following contains DNA from different sources? • Restricted DNA • Recombinant DNA • Reanalyzed DNA • Reconstituated DNA • Resurrected DNA

  48. Which of the following can serve as a vector for DNA? • I. Plasmids • II. Bacteriophages • III.Animal Cells • I only • II only • III only • I and II only • I, II and III

More Related