1 / 49

Faithfulness and Infidelity:

Faithfulness and Infidelity:. Homologous Recombination and DNA Double-Strand Break Repair in Mammalian Cells. Ongoing projects. Fidelity of recombination and DNA double-strand break repair in mammalian genomes “At-risk” DNA motifs in mammalian chromosomes

kami
Télécharger la présentation

Faithfulness and Infidelity:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Faithfulness and Infidelity: Homologous Recombination and DNA Double-Strand Break Repair in Mammalian Cells

  2. Ongoing projects • Fidelity of recombination and DNA double-strand break repair in mammalian genomes • “At-risk” DNA motifs in mammalian chromosomes • Methods for making targeted alterations to a mammalian genome • Influence of gravitational force on recombination and repair • Effect of chemotherapy on genome stability

  3. Homologous Recombination: The exchange of information (nucleotides) between similar DNA sequences.

  4. Recombination is involved in: • Genome maintenance -- DNA repair, replication rescue • Generation of genetic diversity in meiosis • Development of disease (cancer, hypercholesterolemia, age-related disorders) • Gene targeting

  5. noncrossover (gene conversion) crossover Homologous Recombination, Holliday Model

  6. Homologous Recombination, Double-Strand Break Repair noncrossover noncrossover crossover

  7. Problem: How does a cell balance the benefits of efficient DNA recombination & repair against the risk of deleterious rearrangements?

  8. How similar must two sequences be in order to undergo recombination in mammalian chromosomes?

  9. Recombination Rate ~ 10-6 <10-9 homologous homeologous

  10. What we have learned: • Recombination in mammalian cells is very sensitive to small degrees of sequence divergence -- a single mismatch matters • Not all mismatches inhibit recombination to the same degree (C-C or G-G mispairs strongly inhibit recombination) • The minimal amount of contiguous homology needed for efficient recombination is >134 bp

  11. Question: What cellular players are responsible for the exquisite sensitivity of recombination to mismatches ? Likely candidates -- DNA mismatch repair proteins

  12. _________________________ Some known functions of eukaryotic MMR proteins • Mutation avoidance (spell-checking) • Antirecombination • Prevention of homeologous recombination (in yeast and bacteria) • Implicated in DSB repair in yeast • Meiosis • Promotion of meiotic crossovers • Proper segregation of homologs • Cell signaling of certain types of DNA damage • Apoptosis/cell cycle checkpoints • Mutations in certain MMR genes lead to hereditary nonpolyposis colorectal cancer (HNPCC)

  13. MLH1 PMS1 MLH2 MLH3 MLH1 PMS2 PMS1 MLH3 Eukaryotic MutS and MutL homologs: MutS homologs S. cerevisae Mammalian MSH1 MSH2 MSH3 MSH4 MSH5 MSH6 MSH2 MSH3 MSH4 MSH5 MSH6 MutL homologs

  14. Substrates to measure homologous and homeologous recombination: Homologous donor: tk1 hyg tk1 neo H H B B Homeologous donor: tk2 hyg tk1 neo H H B B

  15. Homologous and Homeologous Recombination Frequencies in Mlh1-/- Mouse Embryonic Fibroblasts

  16. Homologous and Homeologous Recombination Frequencies in Msh2-/- Chinese Hamster Ovary Cells

  17. neo B 3.9 kb 3.9 kb neo Screening for gene conversions versus crossovers: Gene conversion: tk1 hyg tk1 B H B 4.5 kb Crossover (“pop-out”): tk1 B B

  18. Representative Southern Blot Analysis of Recombinants (BamHI digests) gene conversion crossover

  19. Conclusion: A single defect in MMR gene Msh2 or Mlh1 does not lift the barrier to spontaneous homeologous recombination in a mammalian genome

  20. What about a possible role for MMR proteins in double-strand break repair?

  21. Accurate Double-Strand Break Repair via Homologous recombination noncrossover crossover

  22. Error-proneNonhomologous End-Joining (NHEJ)

  23. Does MMR have a role in error-prone DSB repair via NHEJ?

  24. DSB induction neo t k Repair by NHEJ t Functional fusion gene (G418R) neo k neo I-SceI Nonfunctional fusion gene (G418S ) neo tk

  25. NHEJ Events-Representative PCR Samples

  26. Sequences of Mlh1+/+ repair junctions: Sequence 5’ to junction Sequence 3’ to junction Del size (L/R) No. clones

  27. Sequences of Mlh1-/- repair junctions Sequence 5’ to junction Sequence 3’ to junction Del size (L/R) No. clones

  28. 51-60 1-10 11-20 21-30 31-40 41-50 61-70 71-80 81-90 91-100 >100 Deletion Sizes Associated with NHEJ 100 Mlh1-/- Median Deletion = 1 bp 80 Frequency of NHEJ events 60 Mlh1+/+ Median Deletion = 46 bp 40 20 0 Number of base pairs deleted

  29. Mlh1-/- Mlh1 +/+ NHEJ Junctions in MMR Proficient Cells Display a Greater Usage of Terminal Homology

  30. Conclusions • No evidence that Mlh1 status affects overall efficiency of NHEJ • NHEJ repair junctions in Mlh1+/+ cells display larger deletions and more terminal microhomology relative to repair junctions in Mlh1-/- cells • Mlh1+/+ cells display a greater frequency of complex rearrangements in association with DSB repair than do Mlh1-/- cells. (Could this be related to the stable karyotypes of HNPCC tumors?)

  31. Conclusions, continued • Both Mlh1+/+ and Mlh1-/- cells are proficient at precise ligation • Msh2+/+ fibroblasts display more microhomology at NHEJ repair junctions than do Msh2-/- fibroblasts

  32. MMR Model for Inhibition of NHEJ by MMR MMR binding to mismatched bases in overlapped ends Collapse of joined intermediate with concomitant end trimming or unwinding Joining of intermediates with suitable homology Gap filling and ligation

  33. Does MMR play a role in accurate recombinational repair of a DSB?

  34. Substrates to measure DSB-induced homologous and homeologous recombination: Homologous donor: tk1 hyg tk1 neo H H B B I-SceI Homeologous donor: tk2 hyg tk1 neo H H B B I-SceI

  35. Spontaneous and DSB-induced Homologous Recombination Frequencies in Msh2+/+ and Msh2-/- Chinese Hamster Ovary Cells

  36. Conclusions: • A DSB can induce high levels of HR in Msh2+/+ and Msh2-/- CHO cells • Gene conversions predominate among spontaneous or DSB-induced HR events in MMR proficient or deficient cells • Gene conversion tracts are longer in Msh2-/- cells than in Msh2+/+ cells • To our knowledge, our work provides the first unequivocal demonstration of accurate recombination as a major DSB repair pathway in a mammalian cell

  37. Future work • Investigate the effects of additional MMR mutations or combinations of MMR mutations in the control of recombination fidelity. • Investigate the role of RecQ family helicases (BLM and WRN) in recombination fidelity and in DSB repair. • Determine if a DSB can by itself provoke homeologous recombination.

  38. Future work, continued • Explore how various genes associated with genome maintenance impact DSB repair pathways in mammalian chromosomes. (Some genes of interest-- p53, BLM, WRN, Ku70/80, BRCA1&2) Useful approaches– use mutant (or K0’d) human and rodent cell lines, and RNAi

  39. Acknowledgments Laura Bannister Yunfu Lin Tamas Lukacsovich Jason Smith

  40. from Christmann et al. (2003) Toxicology 193:3-34

  41. Screen for homologous recombination: Donor: HSV-tk1 Recipient: HSV-tk1 I-SceI Donor sequence: catgtcgggggggaggctgggagtt----------------------cacatgccccgccc Recipient sequence: catatcgggggggaggctgggagctTAGGGATAACAGGGTAATAGCTcacatgccccgccc AluI AluI Recombinant sequence: catgtcgggggggaggctgggagttcacatgccccgccc

  42. Screenfor loss of AluI sites:

  43. HR, revisited This end of newly synthsized DNA can be re-joined to other side of DSB by NHEJ from Schofield and Hsieh (2003) Annu. Rev. Microbiol. 57: 579-608

  44. I-Sce IXba II-Sce I CATCCCTATTGTCCCATTAGATCTATCCCTATTGTCCCATTAGTCGA CAGGGTAAT TATTGTCCCATTA Assay for high-fidelity DSB repair (precise ligation) ____________ GTAGGGATAACAGGGTAATCTAGATAGGGATAACAGGGTAATCAGCT (+47 bp) CAGGGTAATCTAGATAGGGATAA (-23 bp) DSB induction at both I-Sce I sites TAGGGATAA ATCCC precise ligation of DNA termini I-Sce I GTAGGGATAACAGGGTAATCAGCT (+24 bp)

  45. Ways in Which MMR May Block Homeologous Recombination

More Related