1 / 13

3.4: Transcription and Translation

3.4: Transcription and Translation. 3.5.1: Compare the structure of RNA and DNA. 3.5.1: Compare the structure of RNA and DNA. IB Question: Compare the structure and composition of DNA with RNA. [4]. both are polymers of nucleotides / both nucleic acids;

kaz
Télécharger la présentation

3.4: Transcription and Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 3.4: Transcription and Translation

  2. 3.5.1: Compare the structure of RNA and DNA.

  3. 3.5.1: Compare the structure of RNA and DNA.

  4. IB Question: Compare the structure and composition of DNA with RNA. [4] both are polymers of nucleotides / both nucleic acids; sugar is deoxyribose in DNA and ribose in RNA; DNA is double stranded and RNA is single stranded; DNA has a (double) helix; DNA has thymine while RNA has uracil; (require full names written out) both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA; [4 max]

  5. 3.5.2: Outline DNA transcription in terms of the formation of an RNA strandcomplementary to the DNA strand by RNA polymerase.

  6. 3.5.3: Describe the genetic code in terms of codons composed of triplets of bases.

  7. Genetic code

  8. 3.5.4:Explain the process of translation,leading to polypeptide formation.

  9. Translation

  10. What will be the sequence of amino acids from the following mRNA transcript? UAUGGAGCGCUAUCGAUCGUUAGA

  11. IB Question: Explain the process of translation. [8] messenger / mRNA attaches to ribosome (small unit); many ribosome/polyribosomes bind to same mRNA; carries codons / triplet of bases each coding for one amino acid; transfer / tRNA each have specific anticodon; triplet of bases for specific amino acid; tRNA carries specific amino acid; tRNA binds to ribosomes; to corresponding triplet base / codon; a second tRNA binds to next codon; two amino acids bind together; in a peptide linkage; first tRNA detaches; ribosome moves along mRNA; another tRNA binds to next codon; continues until polypeptide / protein formed to stop codon; stop codon has no corresponding tRNA/amino acid / causes release of polypeptide; [8 max]

  12. IB Question: Compare DNA transcription with translation. [4] both require ATP; DNA is transcribed and mRNA is translated; transcription produces RNA and translation produces polypeptides/protein; RNA polymerase for transcription and ribosomes for translation / ribosomes in translation only; transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER; tRNA needed for translation but not transcription; [4 max]

  13. 3.5.5: Discuss the relationship between one gene and one polypeptide. One gene may code for multiple polypeptides due to alternative splicing

More Related