1 / 34

ACE Genotype, CAD and Restenosis After Coronary Stenting

ACE Genotype, CAD and Restenosis After Coronary Stenting. Renin-angiotensin System (RAS) and CAD. Important role in cardiovascular hemodynamics Important role in development and progression of cardiovascular disease Endocrine/paracrine system: ACE major component.

keala
Télécharger la présentation

ACE Genotype, CAD and Restenosis After Coronary Stenting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. ACE Genotype, CAD and Restenosis After Coronary Stenting

  2. Renin-angiotensin System (RAS) and CAD • Important role in cardiovascular hemodynamics • Important role in development and progression of cardiovascular disease • Endocrine/paracrine system: ACE major component

  3. Renin-angiotensin System (RAS) and CAD, cont’d • ACE/angiotensin II/bradykinin system inextricably linked to processes that contribute to generation of atherosclerosis at multiple levels • genetic • molecular • biochemical • pharmacological

  4. Genetic Factors Affecting Circulating RAS - Polymorphisms • Renin • Angiotensinogen • Angiotensin-converting enzyme (ACE) • Angiotensin II Receptor type 1 and 2 (AGTR 1,2)

  5. RAS Function • Circulating renin originates mainly from the kidney (synthesized and stored in juxtaglomerular cells) • Circulating angiotensinogen synthesized in the liver and converted to angiotensin I by renin • ACE converts angiotensin I (inactive decapeptide) to angiotensin II (active octapeptide) • Angiotensin II: the effector of the RAS system: potent vasoconstrictor • Angiotensin III derived from angiotensin II by removal of Asp in position 1 (less potent vasoconstrictor)

  6. ACE Gene • Chromosome 17q23 • Size 21 Kb • Exons 26 (88-481 bp) • Introns 25 (150 bp-2 Kb) • Major mRNAs: endothelial type 4.3 Kb (endothelial cells and brush border of epithelial cells) testicular type 3 Kb • Exon 26 encodes the membrane anchoring segment of ACE protein

  7. Renin-Angiotensin System Angiotensinogen Renin Angiotensin I (Vasoinactive) Angiotensin II (RAS effector: Vasoconstrictor) Kinin - Kallikrein System Kininogen Kallikrein Bradykinin (Vasodilator) Inactive Bradykinin ACE

  8. ACE Protein ACE protease (dipeptidyl carboxypeptidase, DCP 1) • Removes the C-terminal dipeptide His-Leu from Ang I, generating Ang II Effect: activation of a vasoconstrictor • Cleaves the C-terminal dipeptide Phe-Arg from bradykinin (peptide that promotes release of NO, potent vasodilator) Effect: inactivation of a vasodilator

  9. ACE Protein, cont’d • Soluble, circulating ACE: blood, body fluids • Tissue ACE: bound to plasma membrane Most of the ACE molecule projects into extracellular space; membrane binding via C-terminal region that spans across the membrane and ends with a short cytoplasmic tail

  10. ACE Polymorphism • Insertion (I)/Deletion (D): 287 bp insertion sequence in intron 16 • Plasma ACE level is mainly genetically determined: the I/D polymorphism accounts for up to 50% of inter-individual variation • D/D genotype is associated with increased plasma ACE levels: 2x higher than I/I genotype • Correlation of D allele dose to plasma ACE levels is seen in healthy subjects and CAD patients (Caucasians, Japanese), but not in blacks

  11. ACE Genotypes • D allele frequency • Caucasians 54-58% • African-Americans 61% • Japanese 32-39% • D/D genotype: rare in Samoans, Pima Indians, Yanomani Indians

  12. ACE Genotype Frequencies

  13. B. Plasma ACE level A. ACE gene polymorphism % of patients - 593 patients p<0.05 Plasma ACE level (U/L) D/D=deletion/deletion I/D=insertion/deletion I/I=insertion/insertion Genotype Adapted from Ribichini F, et al. Circulation 1998, 1999

  14. ACE Genotyping Methodology • Genomic DNA amplification (Brigitte Rigat et al, Nucl Acid Res, 1992) • PCR primers flanking intron 16 I/D sequence F 5’ CTGGAGACCACTCCCATCCTTTCT 3’ R 5’ GATGTGGCCATCACATTCGTCAGAT 3’ • Amplicon size: 478 bp I allele (insertion 287 bp sequence) 191 bp D allele (deletion 287 bp sequence)

  15. ACE Genotyping Methodology, cont’d • To enhance genotyping and prevent mistyping of heterozygous individuals as DD • DMSO added to reaction mix • Independent PCR confirmation of all DD genotypes (Shanmugam et al, PCR Methods & Applications, 1993)

  16. ACE Mistypingof Heterozygotes • First noted in some family studies • Amplification of the I allele may be suppressed in the ID heterozygote • Mechanism of suppression unclear ? Related to preferential amplification of the shorter sequence (D allele) • Inclusion of DMSO 5% improves amplification of the I allele

  17. ACE Mistyping of Heterozygotes, cont’d • Mistyping is avoided by performing an additional PCR amplification with an insertion specific primer • new F primer: 5’ end of insertion sequence 5’ TTTGAGACGGAGTCTCGCTC 3’ • standard R primer • Amplicon size 408 bp for I allele • II and ID positive amplification • DD allele: no amplification due to lack of annealing site for the new sense primer (insertion specific)

  18. ACE Polymorphism - Genetic Marker For Cardiovascular Disease • Importance of a genetic marker for CAD, MI, hypertension, coronary restenosis: detection could influence treatment and monitoring strategies of individual patients • Positive associations of D allele and D/D genotype - multiple studies • Negative association studies

  19. D Allele - Positive Associations 1. Marker of genetic susceptibility to CAD, MI, left ventricular hypertrophy, cardiac failure (multiple studies) 2. Premature CAD and MI Genotype D/D frequency 50% in patients with first MI at age <50 (average 43 years) Homogeneous Caucasian patient population from Northern Spain (Alvarez et al, 1998) 3. Increased ACE activity due to D/D genotype in patients with MI before age 65 in ECTIM study (Etude Cas-Temoin de l’Infarctus du Myocarde) (Cambien et al, 1994)

  20. D Allele - PositiveAssociations, cont’d 4. D allele associated with increased risk of MI, fatal MI and sudden cardiac death-French study OR for fatal MI 2.2 for D/D and 1.8 of I/D compared to I/I patients (Evans et al, 1994) Interpretation: risk for sudden death conferred by D allele dose is related to several effects of angiotensin II - the end result is rendering the myocardium more susceptible to arrhythmias secondary to vasoconstriction Certain: ACE inhibitors reduce incidence of MI and fatal MIs

  21. D Allele - PositiveAssociations, cont’d 5. D/D genotype: independent risk factor for MI (Nakai et al, 1994; Schuster et al, 1995) 6. D/D genotype association with susceptibility for coronary artery spasm (Oike et al, 1995) 7. D/D genotype associated with predisposition to acute ischemic events (Tiret et al, 1998) 8. D/D genotype and increased ACE associated with increased intima-media thickness (IMT) in common carotid, coronaries and with aortic rigidity (multiple studies)

  22. D Allele - PositiveAssociations, cont’d 9. Synergistic effect of D/D and AGTR 1 CC to increase risk of CAD, including early CAD and MI (Tiret et al, 1994, Bonnardeaux et al, 1994) OR for D/D + CC patients = 5.32 for MI Effect is independent of hypertension 10. D allele is associated with left ventricular dysfunction after MI (Ohmichi et al, 1995) and progressive left ventricular dilatation after the first MI (Pinto et al, 1995)

  23. D Allele - PositiveAssociations, cont’d 11. Patients with idiopathic dilated cardiomyopathy and D/D genotype-worse clinical response to ACE inhibitors (Sakuramoto et al, 1994) 12. Association of D/D genotype with LVH in both hypertensive and normotensive men (Schunkert et al, 1994; Iwai et al, 1994; Prasad et al, 1994)

  24. D Allele - PositiveAssociations, cont’d 13. D/D genotype-risk factor for progression of diabetic nephropathy (and non-diabetic) (Yoshida et al, 1996) 14. D/D genotype-risk factor for thrombosis after surgery (hip arthroplasty); OR for D/D genotype >10 compared to I/I; OR for I/D heterozygotes: 5.0 15. D/D genotype in African-American men associated with increased risk of venous thrombosis (OR 3.0); no association in women

  25. D Allele-NegativeAssociation Studies • ACE genotype not correlated with risk of CAD or MI (Lindpainter et al, NEJM, 1995) - prospective study on subjects from Physicians Health Study excluded high risk group (history angina, MI, stroke, TIAs) • No correlation with risk of MI (Jeunemaitre et al, 1997; Ludwig et al, 1995; Ledru et al, 1998) • D/D genotype not correlated with carotid artery intima-media thickness (Girerd et al, 1998) • No synergistic effect of D/D and ATGR 1 CC genotypes in restenosis after PTCA (Hamon et al, 1998)

  26. Significance of ACE Genotype-Alternative Approaches- Genotype distribution in elite populations Australian Study: Gayagay et al, Hum Genet 1998 • cohort of 64 elite endurance athletes (rowers of Australian national teams selected for the ‘96 Atlanta Olympic Games) • compared to age and sex matched controls • ACE I allele significantly increased frequency in rowers (57% vs. 43%) and I/I genotype in excess (30% vs. 18%) • concomitant underrepresentation of D/D genotype (16% vs. 32%) and lower frequency of D allele (43% vs. 57%)

  27. Australian Study, cont’d Conclusion: • downregulated ACE associated with 1 allele  reduced cardiac afterload, lesser predisposition to atherosclerosis, reduced risk of ventricular hypertrophy and more efficient ventriculo-vascular coupling during exercise • upregulation of ACE in D/D genotypes appears maladaptive and deleterious

  28. Significance of ACE Genotype • Genotype distribution in elite population • French study: Schachter et al, Nature Genet 1994 338 French centenarians (mean age 100.71 years) Increased frequency of D/D genotype and concluded that D/D is associated with longevity Another French paradox

  29. DD and Restenosis Carole Amant et al, Circulation 1997 • 146 patients with stent implantation followed at 6 months-angiography • Minimal lumen diameter (MLD) was not significantly different between the 3 ACE genotypes • At follow-up, MLD had a significant inverse relationship to the number of D alleles • Late luminal loss was >2 fold higher in DD than in II cases • RR restenosis (50% diameter stenosis at follow-up):2.00 in DD cases

  30. ACE D/D and Typeof Restenosis • D allele associated with markedly increased risk for post-stent restenosis • D allele dose also determines long-term clinical outcome (Ribichini et al, 1998, 1999) • Patients with D/D genotype more frequently have a diffuse type of restenosis-aggressive pattern of intimal proliferation (more difficult to treat) • Genotyping may identify a subgroup of patients with poor long-term prognosis after stent implantation

  31. ACE Gene Polymorphism B. Degree of intimal proliferation - 593 patients A. Binary restenosis rates - 593 patients p<0.01 p<0.002 Loss in MLD (mm) Restenosis rate (%) Genotype Genotype D/D=deletion/deletion I/D=insertion/deletion I/I=insertion/insertion MLD=minimum lumen diameter Adapted from Ribichini F, et al. Circulation 1998, 1999

  32. Table 1. Clinical and genetic factors associated with CAD, restenosis after PTCA or restenosis after stent implantation. Reproduced from Ribichini F, Circulation 97:1998

  33. A. Focal restenosis p=NS B. Diffuse restenosis p<0.003 D/D=deletion/deletion I/D=insertion/deletion I/I=insertion/insertion % of patients Adapted from Ribichini F, et al. Circulation 1997

More Related