130 likes | 245 Vues
This presentation delves into the fundamentals of DNA sequencing, highlighting the significant advancements achieved in recent years. With a focus on the Sanger method, it covers essential components, including the role of dideoxynucleotides in halting DNA replication. Moreover, it reviews the sequencing of notable eukaryotic genomes, including *Caenorhabditis elegans*, *Homo sapiens*, *Arabidopsis thaliana*, and *Drosophila melanogaster*. By examining both foundational concepts and modern techniques, this talk aims to illuminate the dramatic progress in genetic research.
E N D
Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them; and to hear those things which ye hear, and have not heard them.
DNA Sequencing Timothy G. Standish, Ph. D.
Sequenced Genomes • Over the past two years large-scale sequencing of eukaryotic genomes has become a reality • Currently the sequencing of at least 4 multicelled eukaryotic genomes has been completed: • 1998 Caenorhabditis elegans - 8 x 107 bp - A nematode worm • 2000 Homo sapiens - 3 x 109 bp - Humans • 2000 Arabidopsis thaliana - 1.15 x 108 - A plant related to mustard • 2000 Drosophila melanogaster - 1.65 x 108 bp - Fruit flies
New Technology • Rapid sequencing of large complex genomes has been made possible by: • Foundational work done over many years and… • Dramatic improvement in DNA sequencing technology over the past few years • In this presentation we will look at both the basic principles of DNA sequencing and how techniques have been refined to yield the dramatic results we now see
Dideoxynucleotides OH Phosphate NH2 HO O P Base N N O N N CH2 5’ O 4’ 1’ Sugar 3’ 2’ OH H H 2’3’-dideoxynucleotide monophosphate • DNA Sequencing using the Sanger method involves the use of 2’3’-dideoxynucleotide triphosphates in addition to regular 2’-deoxynucleotide triphosphates • Because 2’3’-dideoxynucleotide triphosphates lack a 3’ hydroxyl group, and DNA polymerization occurs only in the 3’ direction, once 2’3’-dideoxynucleotide triphosphates are incorporated, primer extension stops 2’-dideoxynucleotide monophosphate
CH3 2’3’dideoxy-nucleotidesTerminateDNAReplication O H OH HN N OH NH2 O P HO O O CH2 N N O O N N CH2 O OH P O OH NH2 B A S E S H O N H2N H O H P HO O N O N N NH 2’3’dideoxynucleotide O SUGAR-PHOSPHATE BACKBONE N N O H2O NH2 N O O CH2 N O CH2 N O HN N O HO P H2N H O O H H P HO O O CH2 O O CH2 O O HO P OH H HO
DNA Sequencing • In DNA sequencing reactions all the basic components needed to replicate DNA are used • 4 reactions are set up, each containing: • DNA Polymerase • Primer • Template to be sequenced • dNTPs • A small amount of one ddNTP • ddATP, ddCTP, ddGTP, ddTTP • As incorporation of ddNTPs terminates DNA replication, a series of fragments is produced all terminating with the ddNTP that was added to each reaction
DNA Sequencing Cloned fragment Primer Primer Binding sites Plasmid (or phage) with cloned DNA fragment
The ddATP Reaction Pol. Pol. Pol. Pol. 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGATGCGATA 5’TTATCGTA Let me Through! Oh come on! Not Again! Agggg…. 5’TTATCGTACCA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGACTAGATGCGA 3’AATAGCATGGTACTGATCTTACGCTAT5’ 5’TTATCG 5’TTATCGTA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGATGCGATA
DNA Sequencing ddATP ddCTP ddGTP ddTTP Read 5’ to 3’ from bottom to top • Products from 4 reactions each containing a small amount of a dideoxynucleotide are loaded onto a gel • Polyacrlyamide gels capable of separating fragments differing in size by only one base • High concentrations of urea are used to prevent formation of double-stranded DNA or secondary structures • Because polymerization goes 5’ to 3’ shortest fragments are 5’ compared to longer fragments which are in the 3’ direction
DNA SequencingWhat A SequencingAutorad ActuallyLooks Like A C G T • To read the autorad it is important to start at the bottom and work up so that it is read in the 5’ to 3’ direction 5’CTAGAGGATCCCCGGGTACCGAGCT...3’
The End