Today…
370 likes | 524 Vues
Genome 351, 8 April 2013, Lecture 3. Today…. The information in DNA is converted to protein through an RNA intermediate ( transcription) The information in the RNA intermediate is converted into protein (translation) DNA & RNA use a triplet code for amino acids
Today…
E N D
Presentation Transcript
Genome 351, 8April 2013, Lecture 3 Today… • The information in DNA is converted to protein through an RNA intermediate (transcription) • The information in the RNA intermediate is converted into protein (translation) • DNA & RNA use a triplet code for amino acids • A gene is a segment of DNA that specifies a protein • Promoters: start sites of transcription
A T C G How does info in DNA flow to protein? The genetic material: DNA -Four subunits (bases A, C, G, T) But virtually all cellular functions are mediated by proteins -Twenty subunits (amino acids)
The RNA Tie Club -Proposed that a transient ribonucleic acid (RNA) intermediate is involved in the conversion of info from DNA to protein
The “Central Dogma” deoxyribose sugar in DNA sugar-phosphate backbone ribose sugar in RNA RNA Bases includeA,C,G,U 5’ DNA Bases includeA,C,G,T DNA is double-stranded RNA is (mostly) single-stranded (G:C & A:U) 3’ RNA DNA Protein
The “Central Dogma” transcription translation DNA mRNA Protein -Information only flows one way -It’s universal (works the same way in prokaryotes & eukaryotes)
mRNA promoter terminator Transcription: copy gene into mRNA to make a specific protein Mendel’s units of information (genes) are particular sequences along the chromosomes. gene gene gene This region from chromsome 7 contains the CFTR (cystic fibrosis gene): CFTR CORTBP2 GASZ 116.9 117.1 117.3 116.7 position in human sequence (millions of bases)
mRNA promoter mRNA Transcription: copy gene into mRNA to make a specific protein gene gene gene promoter A G C 5’ 3’ 3’ 5’ T C G A G C 5’ 3’ C G A 3’ 5’ G C T
Transcription: copy gene into mRNA to make a specific protein coding or sense strand (same sequence as mRNA) T A C 5’ 3’ C A U 3’ 5’ G T A mRNA template strand (complementary to mRNA)
Transcription: copy gene into mRNA to make a specific protein I. initiation II. elongation III. termination
DNA nascent RNA transcripts RNA polymerases Transcription in vivo Where (right or left) is the promoter? gene Which strand (top or bottom) is the template? Which way (right or left) are RNA polymerases moving?
RNA carries the information from DNA in the nucleus to the cytoplasm Transcription DNA RNA Translation Protein
The Morse Code Morse code key Letters: Numbers: … --- … = SOS
How is information coded in DNA? Translating the nucleic acid code (4 different bases) to a protein code (20 aa’s)… Possible coding systems: 1 base per amino acid 2 bases per amino acid 3 bases per amino acid
20 different amino acids and 64 possible combinations of three bases (64 “codons”) Alanine Arginine Aspartic acid Aspargine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Stop Ala Arg Asp Asn Cys GlT Gln Gly His Ile LeT Lys Met Phe Pro Ser Thr Trp Tyr Val A R D N C E Q G H I L K M F P S T W Y V * GCA, GCC, GCG, GCT AGA, AGG, CGA, CGC, CGG, CGT AAC, AAT GAC, GAT TGC, TGT GAA, GAG CAA, CAG GGA, GGC, GGG, GGT CAC, CAT ATA, ATG, ATT TTA, TTG,CTA, CTC, CTG, CTT AAA, AAG ATG TTC, TTT CCA, CCC, CCG, CCT AGC, AGT, TCA, TCC, TCG, TCT ACA,ACC, ACG, ACT TGG TAC, TAT GTA, GTC, GTG, GTT TAA, TAG, TGA There is redundancy (more than one codon) for some amino acids, but each codon specifies only one amino acid
The Genetic Code Table 10.5
Another type of genetic code table = stop = stop
A U mRNA G A C 5’ 3’ U U A U A A C A G A C U C U C A M e t T h r S e r V a l T h r P h e Translation: converting the nucleic acid code to protein The triplet code 3 bases = 1 amino acid More than 1 triplet can code for the same amino acid Translation: read the information in RNA to order the amino acids in a protein protein
start: AUG = methionine, the first amino acid in (almost) all proteins stop: UAA, UAG, and UGA. A U mRNA G A C 5’ 3’ U U A U A A C A G A C U C U C A STOP M e t T h r S e r V a l T h r P h e NH3+ COO- Translation: converting the nucleic acid code to protein Punctuation: protein
Translation of the mRNA requires an RNA adaptor called transfer RNA (tRNA) Each codon has a specific tRNA with a complementary anticodon, linked to a specific amino acid.
Met Met anticodon UAC UAC Recognizes AUG codon in mRNA 5’ AUG 3’ tRNAs ferry amino acids to the mRNA during translation 3’ aminoacyl-tRNA synthetase
The ribosome: mediates translation • A large complex of ribosomal RNAs (rRNAs) & proteins make up a ribosome • Two subunits that join during protein synthesis • rRNAs Provide structural support and serve as catalysts (ribozymes) 5,080 bases of rRNA (2-3 different rRNAs ~49 proteins 1,900 base rRNA ~33 proteins
Met UAC ... Translation ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing ribosome mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Thr Met UAC ... UGA ... Translation ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing ribosome mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Thr Met UAC UGA ... Translation the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… the Met-tRNA is released ribosome mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’ …then ribosome moves over by 1 codon in the 3’ direction
Thr Ser Met AGU ... UGA ... Translation and the next tRNA can bind, and the process repeats mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Ser Met AGU ... Translation Thr UGA mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Met Thr Ser Val Thr Phe UAG ... STOP Translation When the ribosome reaches the Stop codon… termination …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Met Thr Ser Val Thr Phe The finished peptide! NH3+ COO- …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’
Transcription and translation occur in separate compartments in eukaryotes… Transcription Translation
…but bacteria lack a nucleus transcription and translation take place in the same compartment
Questions DNA mRNA ribosome A B Where are the 5’ and 3’ ends of the mRNA?
Questions Which strand on the DNA sequence is the coding (sense) strand? How can you tell?
Questions On the DNA sequence, circle the nucleotides that correspond to the start codon.
Questions How many amino acids are encoded by this gene?
Questions Do you expect the start and stop codons of gene 2 to be represented in the DNA sequence that is shown?
The form of mRNA Translation start Translation stop Non-coding Coding sequence that gets translated into protein Non-coding 5’ 3’ An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence The non-coding portion is often referred to as the ‘untranslated region’ or UTR.