kerry-grimes
Uploaded by
48 SLIDES
565 VUES
480LIKES

SUMMARY

DESCRIPTION

SUMMARY. Sudden Oak Death Deemed introduced because disease was never seen before, mortality rates were very high, and distribution did not match range of hosts

1 / 48

Download Presentation
Télécharger la présentation

SUMMARY

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. SUMMARY • Sudden Oak Death • Deemed introduced because disease was never seen before, mortality rates were very high, and distribution did not match range of hosts • Genetic studies reveal simple genetic structure in forests. Only one lineage of clonally reproducing individuals. AFLPs and microsatellites indicate forest lineage is different from european nursery lineage. In US nurseries three very different lineages are found • Symptoms vary depending on host: in oaks the pathogen causes a girdling necrosis with bleeding on the trunk, on rhodies and bays it cause leaf blight • Epidemiologically important vs. dead-end hosts

  2. US forest isolates clearly distinct from EU nursery isolates, also have different mating type • Isolates from nurseries in WA, OR, & BC both of the US and EU types • Potential for XXX sex and recombination in US nurseries • US forest population is genetically very homogeneous, trademark of an introduced species

  3. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT

  4. We found same genotypes in nurseries and forests proving origin of wild outbreak

  5. Bay/Oak association Bay Coast Live Oak (no sporulation) Canker margin in phloem Bleeding canker Sporangia

  6. Infectious diseases spread not randomly but around initial infections

  7. Duglas-fir sapling branch tip wilted by P. ramorum

  8. Symptoms on Buckeye leaves and petioles

  9. Scorching of maple leaves caused by P. ramorum Spring Autumn

  10. More problems • Host lists started expanding ( now over 100) in all plant families and ferns • Symptoms looked extremely different on different hosts • Isolation of organism from symptomatic tissue often not possible • Isolation success extremely different in different seasons

  11. Environmental sample DNA fingerprints DNA extraction Dna probes (plus/minus) ++-

  12. DNA-based diagnostics ITS1 5.8S ITS2 Phyto1 Phyto2 Phyto3 Phyto4 • Designed 2 sets of P. ramorum specific primers (www primer3 software) • phyto1-phyto4 (1st round PCR) • highly specific for P. ramorum • 687 bp fragment (in between red arrows) • phyto2-phyto3 (2nd round PCR) • nested in phyto1-4 amplicon; specific for Phytophthora spp. • 291 bp fragment (in between yellow arrows)

  13. Culture versus nested PCR Fraction Positive Significant effect of diagnostic type (P <0.001) and sample type (P=0.0036)

  14. The assay we developed became the first DNA assay to diagnose non viral plant pathogens. Now diagnosis of most microbes will be DNA based

  15. Synchrony pathogen-host Susceptibility of oaks (lesion size)

  16. Wetness > 12 h Temp >19 C

  17. Bay Laurel / Tanoak SOD Spore Survey Temp (C) Rain (mm) Date

  18. How to control emergent exotic diseases • PREVENT THEIR INTRODUCTION • LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools) • EMPLOY HOST RESISTANCE • CHEMICAL AND OTHER MITIGATION STRATEGIES

  19. Forest pathogens can never be eradicated

  20. PREVENT: Diagnose Symptoms relatively generic, very variable, and pathogen not always culturable LAB CULTURES DNA TESTS

  21. AgriFos and PentraBark Topical Application +

  22. Agrifos vs. Azomite Treatments (efficacy 1 - 24 months) a a Canker Size (mm) b

  23. New host pathogen combinations • Pathogen stays/Plant moves: invasive plant • Pathogen moves/Plant stays: exotic epidemic • Pathogen moves/Plant moves: biological control

  24. Success. The “1:10” rule • Can exotic withstand new environment • Can it withstand attacks of predators • Can it outcompete similar native organisms by accessing resources • Can a pathogen be pathogenic • Can a pathogen be sufficiently virulent

  25. Invasion driven by ecological conditions • Enemy release hypothesis • Resource availability (pathogenicity/virulence)

  26. Pathogenicity • Qualitative: ability to cause disease • Often regulated by a single gene • Avr genes in pathogen and resistance genes in host

  27. Gene for gene • Resistance in host is dominant • Virulence is recessive ar aR Ar AR

  28. Gene for gene • Resistance in host is dominant • Virulence is recessive ar aR Ar AR Resistance: no disease

  29. Functions of avr/R genes • Avr genes may help detoxify plant enzymes, secure necessary aminoacids or proteins, plant toxins, promoting pathogen growth. Normally they are mobile, wall-bound products • R genes normally recognize multiple avr genes and start hypersensitive response (programmed cell death)

  30. Avr/R genes matches are specific • Race of the pathogen (avr1) matched by variety of the crop (R1). • At the base of crop breeding science • If R genes target avr genes linked to important housekeeping functions, they are more durable

  31. Can be R genes accumulated? • There is a cost associated with R genes • Mostly R genes initiate costly defense processed, often even when challenged by innocuous microbes • Some evidence that in absence of specific avr, R are lost

  32. Plants immune response • Plants do not possess an immune system such as that of animals • They do recognize pathogens • Recognition initiates secondary metabolic processes that produce chemicals that will stop or slow microbial infections: thickening of cell wall, premature cell death (HR response), systemic resistance

  33. Virulence: quantitative response • Multiple genes controlling: • Phenotypic traits conferring virulence • Production of plant detoxifying enzymes • Production of plant toxins

  34. CAN WE PREDICT: • Success of an exotic microbe? • Survival structures such as cysts, spores, etc • Saprotrophic ability (ability to feed on dead matter) • Degree of host specialization, the more specialized the harder it may be to establish • Phylogenetic distance of hosts (the closertive and new hosts are, the easier the establishment) • Similar ecology

  35. CAN WE PREDICT: • Levels of the epidemic? • Density dependance: abundance of susceptible hosts • Genetic variation in host. In general it is assumed that genetic variation in host populations slows down epidemics, however backing data from natural ecosystems is missing. It could be that low genetic diversity associated with widespread presence of resistance may be more beneficial than genetic variability

  36. CAN WE PREDICT: • Selection of increased R in host? • Host: R to exotic may be significantly present because it identifies native pathogen. • R may be absent. • R may be present at low frequency. If host does not exchange genes long distance, but only in areas already infested there is a stronger selection process. Otherwise locally selected R genes may be swamped by genes coming from outside the area of infestation • Shorter generation times favor pathogen

  37. The red queen hypothesis • Coevolutionary arm race • Dependent on: • Generation time has a direct effect on rates of evolutionary change • Genetic variability available • Rates of outcrossing (Hardy-weinberg equilibrium) • Metapopulation structure

  38. CAN WE PREDICT: • Selection of increased virulence in pathogen? • It depends on the presence or absence of trade-off • Does increased virulence make pathogen more fit? • It has been shown that in some cases (but not always), there is a trade-off between virulence and transmission

  39. Rapid generation time of pathogens. Reticulated evolution very likely. Pathogens will be selected for INCREASED virulence if no trade-offs are present • In the short/medium term with long lived trees a pathogen is likely to increase its virulence • In long term, selection pressure should result in widespread resistance among the host

  40. Frequency-, or density dependent, or balancing selection • New alleles, if beneficial because linked to a trait linked to fitness e.g. by conferring advantageous heterozygosity will be positively selected for. • Example: two races of pathogen are present, but only one resistant host variety, suggests second pathogen race has arrived recently • Mating alleles: two mating alleles indicate a single founder individual and high relatedness among genotypes. In a varied natural population you expect multiple mating alleles

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer