kimberly
Uploaded by
24 SLIDES
629 VUES
290LIKES

Chapter 20

DESCRIPTION

Chapter 20. DNA Technology and Genomics. Figure 20.1 DNA microarray that reveals expression levels of 2,400 human genes (enlarged photo). Bacterium. Cell containing gene of interest. Gene inserted into plasmid. 4. 2. 3. 1. Gene of interest. Plasmid. Bacterial chromosome.

1 / 24

Télécharger la présentation

Chapter 20

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 20 DNA Technology and Genomics

  2. Figure 20.1 DNA microarray that reveals expression levels of 2,400 human genes (enlarged photo)

  3. Bacterium Cell containing geneof interest Gene inserted into plasmid 4 2 3 1 Gene of interest Plasmid Bacterialchromosome DNA ofchromosome RecombinantDNA (plasmid) Plasmid put into bacterial cell Recombinatebacterium Host cell grown in culture,to form a clone of cellscontaining the “cloned”gene of interest Gene of interest Protein expressedby gene of interest Copies of gene Protein harvested Basic research and various applications Basic research on protein Basic research on gene Gene used to alterbacteria for cleaningup toxic waste Gene for pestresistance inserted into plants Human growth hormone treatsstunted growth Protein dissolvesblood clots in heartattack therapy Figure 20.2 Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes

  4. 3 1 2 Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction site 5 3 G A A T T C DNA 5 3 C T T A A G Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow G A A T T C C T T A A G Sticky end A A T T C G G DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. C T T A A Fragment from differentDNA molecule cut by thesame restriction enzyme G A A T T C A A T T C G C T T A A T T A A C G G One possible combination DNA ligaseseals the strands. Recombinant DNA molecule

  5. lacZ gene (lactose breakdown) Bacterial cell 3 1 2 Human cell Isolate plasmid DNA and human DNA. Restriction site ampR gene (ampicillin resistance) Gene of interest Bacterial plasmid Stickyends Human DNA Fragments Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Recombinant DNA plasmids Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 1)

  6. lacZ gene (lactose breakdown) Bacterial cell 3 2 1 4 Human cell Isolate plasmid DNA and human DNA. Restriction site ampR gene (ampicillin resistance) Gene of interest Bacterial plasmid Stickyends Human DNA Fragments Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Recombinant DNA plasmids Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinantbacteria Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 2)

  7. lacZ gene (lactose breakdown) Bacterial cell 3 2 4 1 5 Human cell Isolate plasmid DNA and human DNA. Restriction site ampR gene (ampicillin resistance) Gene of interest Bacterial plasmid Stickyends Human DNA Fragments Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Recombinant DNA plasmids Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinantbacteria Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying re-combinant plasmidwith disrupted lacZ gene Colony carrying non-recombinant plasmid with intact lacZ gene Bacterialclone Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 3)

  8. 4 3 2 1 Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, step 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. APPLICATION TECHNIQUE RESULT Colonies containinggene of interest Master plate Master plate ProbeDNA Solutioncontainingprobe Radioactivesingle-strandedDNA Gene ofinterest Film Single-strandedDNA from cell Filter Filter lifted andflipped over Hybridizationon filter The filter is treated to break open the cells and denature their DNA; the resulting single-stranded DNA molecules are treated so that they stick to the filter. A special filter paper ispressed against themaster plate,transferring cells to the bottom side of thefilter. After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. The filter is laid underphotographic film,allowing anyradioactive areas toexpose the film(autoradiography). Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Figure 20.5 Nucleic acid probe hybridization

  9. Foreign genome cut up with restriction enzyme or Recombinantplasmids Bacterialclones Recombinantphage DNA Phageclones (a) Plasmid library (b) Phage library Figure 20.6 Genomic libraries

  10. 3 2 1 3 5 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. 3 5 Genomic DNA 3 5 Denaturation: Heat briefly to separate DNA strands 5 3 TECHNIQUE Annealing: Cool to allow primers to hydrogen-bond. The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. Cycle 1 yields 2 molecules Primers Extension: DNA polymerase adds nucleotidesto the 3 end of each primer Newnucleo-tides RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Figure 20.7 The polymerase chain reaction (PCR)

  11. 1 2 Mixture of DNA molecules of differ- ent sizes Cathode APPLICATION TECHNIQUE RESULTS Gel Power source Glassplates When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Anode Longermolecules Shortermolecules Figure 20.8 Gel Electrophoresis Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources.

  12. Normal  -globin allele 201 bp Large fragment 175 bp DdeI DdeI DdeI DdeI Sickle-cell mutant -globin allele Large fragment 376 bp Ddel Ddel Ddel (a) DdeIrestriction sites in normal and sickle-cell alleles of -globin gene. Sickle-cellallele Normalallele Largefragment 376 bp 201 bp175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Figure 20.9 Using restriction fragment analysis to distinguish the normal and sickle-cell alleles of the -globin gene

  13. 3 1 2 APPLICATION TECHNIQUE Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). Heavyweight Nitrocellulose paper (blot) Restriction fragments DNA + restriction enzyme I II III Gel Sponge Papertowels I Normal -globin allele Alkalinesolution II Sickle-cell allele III Heterozygote Blotting. Gel electrophoresis. Preparation of restriction fragments. Figure 20.10 Southern blotting of DNA fragments

  14. 2 1 RESULTS Probe hydrogen- bonds to fragments containing normal or mutant -globin Radioactively labeled probe for -globin gene is added to solution in a plastic bag I I II II III III Fragment from sickle-cell -globin allele Film over paper blot Fragment from normal -globin allele Paper blot Hybridization with radioactive probe. Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II).

  15. Chromosome bands Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Genes located by FISH 1 Genetic (linkage) mappingOrdering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) Genetic markers 2 Physical mapping Ordering of large over- lapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors Overlappingfragments DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the com- plete genome sequence …GACTTCATCGGTATCGAACT… Figure 20.11 Three-stage approach to mapping an entire genome 3

  16. DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. 3 T G T T 5 APPLICATION TECHNIQUE RESULTS C T G A C T T C G A C A A dATP ddATP 5 dCTP ddCTP DNA polymerase dTTP ddTTP dGTP ddGTP P P P P P P G G This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. OH H 3 Labeled strands DNA (templatestrand) 3 5 ddG A C T G A A G C T G T T C T G A C T T C G A C A A ddA C T G A A G C T G T T ddC T G A A G C T G T T ddT G A A G C T G T T ddG A A G C T G T T ddA A G C T G T T ddA G C T G T T ddG C T G T T ddC T G T T 3 Direction of movement of strands The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Laser Detector G A C T G A A G C Figure 20.12 Dideoxy chain-termination method for sequencing DNA

  17. 1 2 3 4 Figure 20.13 Whole-genome shotgun approach to sequencing Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing. Clone the fragments in plasmid or phage vectors Sequence each fragment ACGATACTGGT CGCCATCAGT ACGATACTGGT Order the sequences into one overall sequence with computer software. AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA…

  18. Table 20.1 Genome Sizes and Estimated Numbers of Genes*

  19. 1 4 3 2 APPLICATION TECHNIQUE RESULT Isolate mRNA. Make cDNA by reverse transcription, using fluorescently labeled nucleotides. Apply the cDNA mixture to a microarray, a microscope slide on which copies of single-stranded DNA fragments from the organism’s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Figure 20.14 Research Method DNA microarray assay of gene expression levels With this method, researchers can test thousands of genes simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. Tissue sample mRNA molecules Labeled cDNA molecules (single strands) DNA microarray Size of an actual DNA microarray with all the genes of yeast (6,400 spots)

  20. RFLP marker DNA Disease-causing allele Restriction sites Normal allele Figure 20.15 RFLPs as markers for disease-causing alleles

  21. Cloned gene (normal allele, absent from patient’s cells) 1 2 3 4 Insert RNA version of normal allele into retrovirus. Viral RNA Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. Retrovirus capsid Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient Inject engineered cells into patient. Figure 20.16 Gene therapy using a retroviral vector

  22. Blood from defendant’s clothes Victim’s blood (V) Defendant’s blood (D) 4 g 8 g V Jeans D shirt Figure 20.17 DNA fingerprints from a murder case

  23. Figure 20.18 “Pharm” animals

  24. 2 1 3 Agrobacterium tumefaciens Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. APPLICATION TECHNIQUE RESULT Tiplasmid Site where restriction enzyme cuts The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. T DNA DNA with the gene of interest Recombinant Ti plasmid Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. Plant with new trait Figure 20.19 Using the Ti plasmid to produce transgenic plants

More Related