20 likes | 124 Vues
Quiz#10 LC710 10/27/10 name___________. Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present. CMVp. rtta I.R.E.S GFP. tetO. TATA. RFP. Q1 0.5 pt (circle one) :. Q2 0.5 pt (circle one) :. Cellular Fluorescence observed
E N D
Quiz#10 LC710 10/27/10 name___________ Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present CMVp rtta I.R.E.S GFP tetO TATA RFP Q1 0.5 pt (circle one) : Q2 0.5 pt (circle one) : Cellular Fluorescence observed prior to addition of Doxycycline is: Red Green Both Neither Cellular Fluorescence observed after addition of Doxycycline is: Red Green Both Neither Q3: 1pt What does tta do in the absence of Dox?________________________ What does tta do in the presence of Dox?________________________
Given the following transgenes co-existing in the same animal. 4 8 3 Pax6p 12 7 2 CreERt2 I.R.E.S GFP 11 6 1 10 5 Hox1p 9 loxP-RFP-loxP-TOXIN Above are WT cells in the brain expressing Pax6 and/or Hox1. If expressed, TOXIN will Kill cells (disappear) Q4 (2pts) Q5 (2pts) Prior to addition of TAM, which Cells are: After TAM addition, which Cells are: Red only: Green only: Both: Neither: Red only: Green only: Both: Neither: TAM= TAMOXIFEN Q6 (2pts) : in the above transgene, loxP sites are in this orientation: = loxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT This experiment is actually poorly designed and the loxP sites need to oriented as follows: Hox1p Why?