CLINICAL GENOMICS CENTRE PROTEOMICS GROUP

1. Who we are?.. CLINICAL GENOMICS CENTRE PROTEOMICS GROUP

2. What do we do?..

3. How do we do it fast?.. simplified procedure Cloning in 96 format Genomic DNA Amplification with proofreading Pol (Pfx) PCR product Restriction Purification T7 His-tag Tev cleavage site HM GS STOP Apr T7 Tev cleavage site HM GS His-tag STOP Kmr Confirmation of cloning by PCR

4. How we do it fast?.. Test for expression/solubility in 96 format NusA 5 5 5 5 5 4 5 3 5 2 5 1 5 0 Cell lysate Soluble fraction

5. What are the slow steps?.. Parallel purification of the soluble proteins 6-12 proteins per person Crystal trials Crystal optimization

6. 1750 clones

7. 100 90 80 70 60 50 40 30 20 10 0 Methanobacterium Escherichia coli Thermotoga thermoautotrophicum maritima cloned expressed soluble

8. Automation bottlenecks in cloning and expression Collart et al. 2002

9. Cloning Expression Analysis Targets Automated methods Semi automated methods Cryovials Plasmid plates Clone isolation Expression/solubility validation Expression Cloning Strategy 75% Soluble proteins Collart et al. 2002

10. Bottlenecks: Manual and Semi automated components Clone Isolation Expression/Solubility verification Project Integration Bacterial growth and induction Collart et al. 2002

11. Clone isolation - cloning efficiency Expression efficiency at 2-colony analysis level 87% Ligation Independent Cloning Collart et al. 2002

12. Clone Validation- Sequence Analysis ATGTTAACAAAATCCGCAGAGAATAAGCGGAA ATGTTAACAAAATCCGCAGAGAATAAGCGGAA AGGAAAATGGATGGACATACGAGAAAAAATAG AGGAAAATGGATGGACATACGAGAAAAAATAA N-term C-term Sequence Analysis 5-10% of clones Sequence match 54% Error 6 Mismatch 40 ATGTTAACAAAATCCGCAGAGAATAAGCGGAAC ATGTTAACAAAATCCGCAGAGAATAAGCGGAAC No C-terminal sequence match N-term

13. Integration –target priority APC1606- Aspartokinase (185) APC1589- Quinolinate synthetase A (64) Hypothetical proteins APC1574- regulatory protein (452) Collart et al. 2002

14. Example - Overnight induction at 30° • 200 ml in 1L flask • Induction at OD = 5.1-8.4 • Harvest next morning • Final OD = 22-35 • Solubility corresponds well with solubility screen results • 30°, 37° similar expression • Workflow options • Scale up possible • Fernbach flasks Donnelly et al. 2002

15. Challenges for HTP protein purification: Quantity andQuality • “universal” purification protocol for a diverse set of proteins • scale equivalent to cloning and structure determination • feasible and economical • as few steps as possible • as fast as possible • minimize aggregation problem ….. Dementieva et al. 2002

16. protease time hr t C success rate, % specificity thrombin 16-24 25-37 ~90 -/+ factor Xa 16-60 25-37 ~60 +/- rTEV 1-3 4-30 ~95 + Expression construct selection His thrombin protein pET15b • Affinity tag • small • disorder • easy to remove • (protease) • Protease • specificity • fast • cheap • tagged His thrombin S Xa protein pET30LIC His Xa protein MCSG3 pRroEX(ENLYFQG) His TEV protein MCSG7 (ENLYFQS) His TEV protein Tag cleavage efficiency Dementieva et al. 2002

17. Purification protocol:as few steps as possible crude • IMAC I usually provides a major • step of the purification • IMAC II removes His-TEV and • persistent contaminant proteins • in E.coli host • Gel-filtration – “polishing” • before crystal optimization IMAC I tag cleavage IMAC II gel filtration Milligram-scale protein production crystallization (screen) 24 20 Crystallization (optimization) Proteinnumber 8 Se-Met protein 2 2 2-5 5-10 10-20 20-40 >50 mg pure protein per 1 L culture Dementieva et al. 2002

18. With or without tag ? Dementieva et al. 2002

19. COND UV 7 1 6 8 2 1 7 5 3 2 6 4 3 Pump A PUMP A PUMP B A2 B1 B2 8 1 2 3 5 W2 Affinity + buffer exchange (AKTA platform, Pharmacia) Buffer exchange Semi-automated - chromatography system for simultaneous protein purification MIXER Affinity Buffer exchange Fraction Collector 5 4 Outlet Valve NO NC NO NC 8 1 7 2 6 3 5 4 30 min BufferValve F4 F5 F6 F3 8 8 1 7 1 7 2 6 2 6 3 5 3 5 4 4 11 12 13 14 15 16 17 18 7 Affinity columns Dementieva et al. 2002

20. Quality control: as fast as possible Dementieva et al. 2002

21. MCSG Protein Purification Database “Notebook” • Protein Purification Database “Notebook” is fully searchable throughout results of purification. • User is able to use APC number Host identifier or Vector description as keys for his search. • The MCSG Report Field is connected directly to MCSG Report Website (http://www.mcsg.anl.gov/target) and is updating corresponding filed for purification progress report. • SDS Gel Button is connected through the File Report mechanism to Agilent 2100 Bio Sizing Software for separation results. • Chromatography Button invokes connection to File Report mechanism to Pharmacia Purification Robot Software. Dementieva et al. 2002

22. Invaginations of the cell membrane unique to species of Rhodobacter Model of Rhodobacter cells underscoring key features Electron micrographs of two Rhodobacter deletion strains Laible et al., 2002 A strategy to produce membrane proteinsfor structural genomics Advantage of the Rhodobacter expression system: This organism can be engineered to provide coordinated synthesis of foreign membrane proteins with synthesis of new membrane into which they can be incorporated.

23. Additional features of the Rhodobacter membrane protein expression system • Membrane invaginations are easily isolated by ultracentrifugation • Cell color indicates correct induction conditions for expression of the host membrane and foreign genes • Relatively high expression yields of hypothetical membrane proteins of E. coli have been observed • SeMet is readily incorporated into induced proteins with similar yield and purity issues as soluble SeMet protein derived from E. coli Laible et al., 2002

24. Expression vector (traditional ligation methodologies shuttle foreign genes in place of antenna genes in the puf operon) Rhodobacter host (an engineered strain that lacks all antenna and RC proteins of the photosysnthetic apparatus) Current Rhodobacter Expression System Laible et al., 2002

25. Progress with MCSG membrane protein targets 150 membrane proteins are currently being pursued • Target selection • Concentrate on membrane proteins from E. coli that have no known homolog in the PDB • If a Rhodobacter homolog of the E. coli target exists, then it is also aggressively pursued • Maximize information obtained from a single structure by focusing on protein families with many members • Select targets exhibiting a wide range of MW, pIs, and hydropathy plot signatures • Progress • Targets cloned with > 90% efficiency • Expression analysis is underway • Initial screening shows ~15% of clones express well; some have expression levels that rival those of native proteins of the photosynthetic apparatus Laible et al., 2002

26. Culture and Purification Only 1 major step (*) novel to membrane protein purification Laible et al., 2002

27. Examples of successful expression and purification from first round of targets Expression levels of several proteins rival or exceed levels of highly-expressed, native Rhodobacter membrane proteins. Laible et al., 2002

28. Acknowledgments NIH (R01 GM61887) Planned improvements for Rhodobacter expression system • Employ smaller broad-host-range vector • Introduce LIC methodologies • Automate purification • Optimize ribosome binding site • Investigate leader sequences and placement of affinity tag • Co-express chaperones • Knock out proteases Laible et al., 2002