120 likes | 194 Vues
Leader in Applied Cereal Genomics. i-LIMS Bridging the Information Gap between Genotypes and Phenotypes in Plants. K. BRUYNSEELS, L. VERVOORT. TraitMill : Lead discovery. Gene selection. 10.000’s candidates. 10’s leads. Field trials. Vector construction. Identification of leads.
E N D
i-LIMS Bridging the Information Gap between Genotypes and Phenotypes in Plants K. BRUYNSEELS, L. VERVOORT
TraitMill : Lead discovery Gene selection 10.000’s candidates 10’s leads Field trials Vector construction Identification of leads Crop transformation 100’s hits Figure 5 1000’s screened Seed image analysis Quality check by Q-PCR. Seed counting Automated plant handling (greenhouse) Plant image analysis Plant imaging confidential
TraitMill : Data generated Gene selection Field trials Vector construction Identification of leads Crop transformation Figure 5 Seed image analysis Quality check by Q-PCR. Seed counting Automated plant handling (greenhouse) Plant image analysis Plant imaging confidential
TraitMill : Data generated Bioinformatics Gene selection Field trials Vector construction Identification of leads (patents) Crop transformation Figure 5 Seed image analysis Quality check by Q-PCR. Seed counting Automated plant handling (greenhouse) Plant image analysis Plant imaging confidential
TraitMill : Data generated Bioinformatics Gene selection Field trials Vector construction Identification of leads (patents) LIMS Crop transformation Figure 5 Seed image analysis Quality check by Q-PCR. Seed counting Automated plant handling (greenhouse) Plant image analysis Plant imaging confidential
Lab Information management system • Fully integrated database system • Linking materials flow – data flow aattggctgaatcgtatgggccta aaagctgcctcggcctcgtaatat Gene database Operations database Plant evaluation database Bioinformatics toolbox Statistical analysis toolbox confidential
Lab Information management system Challenges Implement in an existing lab environment where info is already available (cleanup!) Implement in an dynamic environment (scientists) Diversity of information (sequences, images, ...) Diversity of processes (links information) confidential
Lab Information management system Goals Vendor Independent Central Management • Lower maintenance time and cost • Lower the ‘cost of ownership’ of the desktop Platform independent Framework to enable the plug in of external components confidential
Lab Information management system software module map Security Planning Reporting Accounting Gene DB GDG PocketPC Automation BioRobot BioInf LIMS VCG Sequencing Stat Strain Collection Swift PTG CD Storage Aris Quetzal PEG Various confidential
gene db RDBI Features on sequences, meta-information LIMS SQL queries SQL queries Homology search AUTOMATED ANNOTATION Motifs search Objects (biological representation) Predictions MANUAL ANNOTATION Domain experts Object serialization Communication layer RMI Client standalone application or web interface confidential
Lab Information management system Software demo / presentation i-LIMS Version 3! confidential