1 / 47

Parsing A Bacterial Genome

Parsing A Bacterial Genome. Mark Craven Department of Biostatistics & Medical Informatics University of Wisconsin U.S.A. craven@biostat.wisc.edu www.biostat.wisc.edu/~craven. The Task. Given : a bacterial genome

kristy
Télécharger la présentation

Parsing A Bacterial Genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Parsing A Bacterial Genome Mark Craven Department of Biostatistics & Medical Informatics University of Wisconsin U.S.A. craven@biostat.wisc.edu www.biostat.wisc.edu/~craven

  2. The Task Given: a bacterial genome Do: use computational methods to predict a “parts list” of regulatory elements

  3. Outline • background on bacterial gene regulation • background on probabilistic language models • predicting transcription units using probabilistic language models • augmenting training with “weakly” labeled examples • refining the structure of a stochastic context free grammar

  4. The Central Dogma of Molecular Biology

  5. Transcription in Bacteria

  6. terminator promoter gene gene gene Operons in Bacteria mRNA • operon: sequence of one or more genes transcribed as a unit under some conditions • promoter: “signal” in DNA indicating where to start transcription • terminator: “signal” indicating where to stop transcription

  7. The Task Revisited Given: • DNA sequence of E. coli genome • coordinates of known/predicted genes • known instances of operons, promoters, terminators Do: • learn models from known instances • predict complete catalog of operons, promoters, terminators for the genome

  8. Our Approach: Probabilistic Language Models • write down a “grammar” for elements of interest (operons, promoters, terminators, etc.) and relations among them • learn probability parameters from known instances of these elements • predict new elements by “parsing” uncharacterized DNA sequence

  9. Transformational Grammars • a transformational grammar characterizes a set of legal strings • the grammar consists of • a set of abstract nonterminal symbols • a set of terminal symbols (those that actually appear in strings) • a set of productions

  10. A Grammar for Stop Codons • this grammar can generate the 3 stop codons: taa, tag, tga • with a grammar we can ask questions like • what strings are derivable from the grammar? • can a particular string be derived from the grammar?

  11. The Parse Tree for tag

  12. A Probabilistic Version of the Grammar 1.0 1.0 0.7 0.2 • each production has an associated probability • the probabilities for productions with the same left-hand side sum to 1 • this grammar has a corresponding Markov chain model 0.8 0.3 1.0

  13. c u u a c c g stem g c c g c g a u prefix loop g c suffix c-u-c-a-a-a-g-g- c g -u-u-u-u-u-u-u-u A Probabilistic Context Free Grammar for Terminators PREFIX STEM_BOT1 SUFFIX START B B B B B B B B B PREFIX tlSTEM_BOT2tr STEM_BOT1 tl*STEM_MIDtr* | tl*STEM_TOP2tr* STEM_BOT2 tl*STEM_MIDtr* | tl*STEM_TOP2tr* STEM_MID STEM_TOP2 tl*STEM_TOP1tr* STEM_TOP1 tlLOOPtr LOOP B B LOOP_MID B B LOOP_MID B LOOP_MID | SUFFIX B B B B B B B B B a| c | g | u B t = {a,c,g,u}, t* = {a,c,g,u,}

  14. Inference with Probabilistic Grammars • for a given string there may be many parses, but some are more probable than others • we can do prediction by finding relatively high probability parses • there are dynamic programming algorithms for finding the most probable parse efficiently

  15. Learning with Probabilistic Grammars • in this work, we write down the productions by hand, but learn the probability parameters • to learn the probability parameters, we align sequences of a given classs (e.g. terminators) with the relevant part of the grammar • when there is hidden state (i.e. the correct parse is not known), we use Expectation Maximization (EM) algorithms

  16. Outline • background on bacterial gene regulation • background on probabilistic language models • predicting transcription units using probabilistic language models [Bockhorst et al., ISMB/Bioinformatics ‘03] • augmenting training with “weakly” labeled examples • refining the structure of a stochastic context free grammar

  17. stem loop RIT suffix ORF intra ORF RIT prefix spacer -35 prom intern -10 post prom TSS UTR last ORF pre term end spacer end RDT prefix start spacer start stem loop RDT suffix SCFG ORF position specific Markov model semi-Markov model A Model for Transcription Units untranscribed region transcribed region

  18. position-specific Markov models represent fixed-length sequence motifs • semi-Markov models represent variable-length sequences The Components of the Model • stochastic context free grammars (SCFGs) represent variable-length sequences with long-range dependencies

  19. Gene Expression Data experimental conditions • in addition to DNA sequence data, we also use expression data to make our parses • microarrays enable the simultaneous measurement of the transcription levels of thousands of genes genes/ sequence positions

  20. ACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCTAGCTGACAGCTAGATCGATAGCTCGATAGCACGTGTACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCTACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCTAGCTGACAGCTAGATCGATAGCTCGATAGCACGTGTACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCT Incorporating Expression Data • our models parse two sequences simultaneously • the DNA sequence of the genome • a sequence of expression measurements associated with particular sequence positions • the expression data is useful because it provides information about which subsequences look like they are transcribed together

  21. Predictive Accuracy for Operons

  22. Predictive Accuracy for Promoters

  23. Predictive Accuracy for Terminators

  24. Accuracy of Promoter & Terminator Localization

  25. Terminator Predictive Accuracy

  26. Outline • background on bacterial gene regulation • background on probabilistic language models • predicting transcription units using probabilistic language models • augmenting training data with “weakly” labeled examples [Bockhorst & Craven, ICML ’02] • refining the structure of a stochastic context free grammar

  27. Key Idea: Weakly Labeled Examples • regulatory elements are inter-related • promoters precede operons • terminators follow operons • etc. • relationships such as these can be exploited to augment training sets with “weakly labeled”examples

  28. g2 g3 g4 g1 ACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCTAGCTGACAGCTAGATCGATAGCTCGATAGCACGTGTACGTAGATAGACAGAATGACAGATAGAGACAGTTCGCT TGCATCTATCTGTCTTACTGTCTATCTCTGTCAAGCGATCGACTGTCGATCTAGCTATCGAGCTATCGTGCACATGCATCTATCTGTCTTACTGTCTATCTCTGTCAAGCGA • if we know that an operon ends at g4, then there must be a terminator shortly downstream g5 • if we know that an operon begins at g2, then there must be a promoter shortly upstream Inferring “Weakly” Labeled Examples • we can exploit relations such as this to augment our training sets

  29. Strongly vs. Weakly Labeled Terminator Examples strongly labeled terminator: sub-class: rho-independent end of stem-loop gtccgttccgccactattcactcatgaaaatgagttcagagagccgcaagatttttaattttgcggtttttttgtatttgaattccaccatttctctgttcaatg extent of terminator weakly labeled terminator: gtccgttccgccactattcactcatgaaaatgagttcagagagccgcaagatttttaattttgcggtttttttgtatttgaattccaccatttctctgttcaatg

  30. Training the Terminator Models:Strongly Labeled Examples rho-independent examples rho-dependent examples negative examples negative model rho-independent terminator model rho-dependent terminator model

  31. Training the Terminator Models:Weakly Labeled Examples weakly labeled examples negative examples rho-independent terminator model rho-dependent terminator model negative model combined terminator model

  32. Do Weakly Labeled Terminator Examples Help? • task: classification of terminators (both sub-classes) in E. coli K-12 • train SCFG terminator model using: • S strongly labeled examples and • W weakly labeled examples • evaluate using area under ROC curves

  33. Learning Curves using Weakly Labeled Terminators 1 0.9 0.8 Area under ROC curve 0.7 250 weak examples 0.6 25 weak examples 0 weak examples 0.5 0 20 40 60 80 100 120 140 Number of strong positive examples

  34. Are Weakly Labeled Examples Better than Unlabeled Examples? • train SCFG terminator model using: • S strongly labeled examples and • U unlabeled examples • vary S and U to obtain learning curves

  35. Training the Terminator Models:Unlabeled Examples unlabeled examples rho-independent terminator model rho-dependent terminator model negative model combined model

  36. 0 40 80 120 120 0 40 80 Learning Curves: Weak vs. Unlabeled Weakly Labeled Unlabeled 1 0.8 Area under ROC curve 250 weak examples 250 unlabeled examples 25 weak examples 25 unlabeled examples 0.6 0 weak examples 0 unlabeled examples Number of strong positive examples

  37. Are Weakly Labeled Terminators from Predicted Operons Useful? • train operon model with S labeled operons • predict operons • generate W weakly labeled terminators from W most confident predictions • vary S and W

  38. Learning Curves using Weakly Labeled Terminators 1 0.9 0.8 Area under ROC curve 0.7 200 weak examples 100 weak examples 0.6 25 weak examples 0 weak examples 0.5 0 20 40 60 80 100 120 140 160 Number of strong positive examples

  39. Outline • background on bacterial gene regulation • background on probabilistic language models • predicting transcription units using probabilistic language models • augmenting training with “weakly” labeled examples • refining the structure of a stochastic context free grammar [Bockhorst & Craven, IJCAI ’01]

  40. Learning SCFGs • given the productions of a grammar, can learn the probabilities using the Inside-Outside algorithm • we have developed an algorithm that can add new nonterminals & productions to a grammar during learning • basic idea: • identify nonterminals that seem to be “overloaded” • split these nonterminals into two; allow each to specialize

  41. 0.4 0.1 0.1 0.4 0.1 0.4 0.4 0.1 • if the probabilities for look very different, depending on its context, we add a new nonterminal and specialize Refining the Grammar in a SCFG • there are various “contexts” in which each grammar nonterminal may be used • consider two contexts for the nonterminal

  42. 0.4 0.1 0.1 0.4 0.1 0.4 0.4 0.1 Refining the Grammar in a SCFG • we can compare two probability distributions P and Q using Kullback-Leibler divergence Q P

  43. Learning Terminator SCFGs • extracted grammar from the literature (~ 120 productions) • data set consists of 142 known E. coli terminators, 125 sequences that do not contain terminators • learn parameters using Inside-Outside algorithm (an EM algorithm) • consider adding nonterminals guided by three heuristics • KL divergence • chi-squared • random

  44. SCFG Accuracy After Adding 25 New Nonterminals

  45. SCFG Accuracy vs. Nonterminals Added

  46. Conclusions • summary • we have developed an approach to predicting transcription units in bacterial genomes • we have predicted a complete set of transcription units for the E. coli genome • advantages of the probabilistic grammar approach • can readily incorporate background knowledge • can simultaneously get a coherent set of predictions for a set of related elements • can be easily extended to incorporate other genomic elements • current directions • expanding the vocabulary of elements modeled (genes, transcription factor binding sites, etc.) • handling overlapping elements • making predictions for multiple related genomes

  47. Acknowledgements • Craven Lab: Joe Bockhorst, Keith Noto • David Page, Jude Shavlik • Blattner Lab: Fred Blattner, Jeremy Glasner, Mingzhu Liu, Yu Qiu • funding from National Science Foundation, National Institutes of Health

More Related