lavina
Uploaded by
7 SLIDES
213 VUES
70LIKES

Genomics and Information Sharing

DESCRIPTION

Genomics and Information Sharing. Workshop on Access and Benefit Sharing in Non-Commercial Biodiversity Research Bonn, Germany 17-19 November 2008 Christian Burks Ontario Genomics Institute & Vice-Chair, iBOL Board of Directors.

1 / 7

Télécharger la présentation

Genomics and Information Sharing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genomics and Information Sharing Workshop on Access and Benefit Sharing in Non-Commercial Biodiversity Research Bonn, Germany 17-19 November 2008 Christian Burks Ontario Genomics Institute & Vice-Chair, iBOL Board of Directors

  2. 1 ccttcgcgccctgggccatctccctcccacctccctccgcggagcagccagacagcgagg 61 gccccggccgggggcaggggggacgccccgtccggggcacccccccggctctgagccgcc 121 cgcggggccggcctcggcccggagcggaggaaggagtcgccgaggagcagcctgaggccc 181 cagagtctgagacgagccgccgccgcccccgccactgcggggaggagggggaggaggagc 241 gggaggagggacgagctggtcgggagaagaggaaaaaaacttttgagacttttccgttgc 301 cgctgggagccggaggcgcggggacctcttggcgcgacgctgccccgcgaggaggcagga 361 cttggggaccccagaccgcctccctttgccgccggggacgcttgctccctccctgccccc 421 tacacggcgtccctcaggcgcccccattccggaccagccctcgggagtcgccgacccggc 481 ctcccgcaaagacttttccccagacctcgggcgcaccccctgcacgccgccttcatcccc 541 ggcctgtctcctgagcccccgcgcatcctagaccctttctcctccaggagacggatctct 601 ctccgacctgccacagatcccctattcaagaccacccaccttctggtaccagatcgcgcc 661 catctaggttatttccgtgggatactgagacacccccggtccaagcctcccctccaccac 721 tgcgcccttctccctgaggacctcagctttccctcgaggccctcctaccttttgccggga 781 gacccccagcccctgcaggggcggggcctccccaccacaccagccctgttcgcgctctcg 841 gcagtgccggggggcgccgcctcccccatgccgccctccgggctgcggctgctgccgctg 901 ctgctaccgctgctgtggctactggtgctgacgcctggccggccggccgcgggactatcc 961 acctgcaagactatcgacatggagctggtgaagcggaagcgcatcgaggccatccgcggc 1021 cagatcctgtccaagctgcggctcgccagccccccgagccagggggaggtgccgcccggc 1081 ccgctgcccgaggccgtgctcgccctgtacaacagcacccgcgaccgggtggccggggag 1141 agtgcagaaccggagcccgagcctgaggccgactactacgccaaggaggtcacccgcgtg 1201 ctaatggtggaaacccacaacgaaatctatgacaagttcaagcagagtacacacagcata 1261 tatatgttcttcaacacatcagagctccgagaagcggtacctgaacccgtgttgctctcc 1321 cgggcagagctgcgtctgctgaggctcaagttaaaagtggagcagcacgtggagctgtac 1381 cagaaatacagcaacaattcctggcgatacctcagcaaccggctgctggcacccagcgac 1441 tcgccagagtggttatcttttgatgtcaccggagttgtgcggcagtggttgagccgtgga 1501 ggggaaattgagggctttcgccttagcgcccactgctcctgtgacagcagggataacaca 1561 ctgcaagtggacatcaacgggttcactaccggccgccgaggtgacctggccaccattcat 1621 ggcatgaaccggcctttcctgcttctcatggccaccccgctggagagggcccagcatctg 1681 caaagctcccggcaccgccgagccctggacaccaactattgcttcagctccacggagaag 1741 aactgctgcgtgcggcagctgtacattgacttccgcaaggacctcggctggaagtggatc 1801 cacgagcccaagggctaccatgccaacttctgcctcgggccctgcccctacatttggagc 1861 ctggacacgcagtacagcaaggtcctggccctgtacaaccagcataacccgggcgcctcg 1921 gcggcgccgtgctgcgtgccgcaggcgctggagccgctgcccatcgtgtactacgtgggc 1981 cgcaagcccaaggtggagcagctgtccaacatgatcgtgcgctcctgcaagtgcagctga 2041 ggtcccgccccgccccgccccgccccggcaggcccggccccaccccgccccgcccccgct 2101 gccttgcccatgggggctgtatttaaggacacccgtgccccaagcccacctggggcccca 2161 ttaaagatggagagaggactgcggatctctgtgtcattgggcgcctgcctggggtctcca 2221 tccctgacgttcccccactcccactccctctctctccctctctgcctcctcctgcctgtc 2281 tgcactattcctttgcccggcatcaaggcacaggggaccagtggggaacactactgtagt 2341 tagatc DNA – 2346 base pairs (one gene) human transforming growth factor (GenBank) 3,000 bp = one PhD (circa early 1980’s) one human genome = 3,000,000,000 bp one human genome = 1,000,000 PhDs • but, technology improved • faster • less human intensive so let’s do “genomics”! • first human genome ... 2003

  3. funding outcomes impact & benefits • RESULTS • leverageable resources: • knowledge • methods • tools • databases • reagents • clones • . • . • . What is Genomics?A New, Outcome-Oriented Research Paradigm APPLICATIONS

  4. Genomics Projects: Key Issues for Data Release • Required by contract with relevant funders • funded after approval of data release policy • Preliminary data are released publicly: • within hours or days after being generated • subject to systematic quality control standards • and not delayed by final scientific interpretation • and not delayed by invention disclosures • and not delayed by publication in a journal • “community resource projects” framework: • Ft. Lauderdale report (see wiki posting)

  5. Genomics Project Public Databases: Value Proposition • The existence of a “complete” (holistic) set • providing boundary values for biological calculus • whole greater than sum of parts • Data generated and maintained systematically: • standards defined and agreed upon in advance • maximum levels of error • minimum levels and means of annotation • recourse to source (raw) data and materials • Data there for benefit of and shared with all: • Publicly available over the world wide web • No limitations … any/all can retrieve & add value

  6. Genomics Coming to DNA Barcoding Trematomus scotti (blackfin notothen, from GenBank) – 2003 – concept initiated <100 visible (imbedded)? • LOCUS EU326435 652 bp DNA linear VRT 22-OCT-2008 • DEFINITION Trematomus scotti voucher JRAS06-086 cytochrome oxidase subunit 1 • (COI) gene, partial cds; mitochondrial. • ACCESSION EU326435 • VERSION EU326435.1 GI:164449557 • KEYWORDS BARCODE. • SOURCE mitochondrion Trematomus scotti (blackfin notothen) • ORGANISM Trematomus scotti • Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; • Actinopterygii; Neopterygii; Teleostei; Euteleostei; Neoteleostei; • Acanthomorpha; Acanthopterygii; Percomorpha; Perciformes; • Notothenioidei; Nototheniidae; Trematomus. • . • . • . • ORIGIN • 1 tctttacttagtcttcggcgcttgggccgggatagtaggaacagcccttagtctgctcat • 61 tcgggcagaacttagtcaacccggcgccctattgggggacgaccaaatttataatgttat • 121 tgttaccgcccatgcctttgtaataatcttctttatggtaatgcctatcataatcggggg • 181 ttttggaaattgacttatccccctcatgattggggcccctgacatggcgtttcctcgaat • 241 aaacaatatgagcttctggcttttgccgccctccttcctgctactgttagcttcttcagg • 301 tgttgaagcgggggcagggaccgggtggactgtttatcctcctctctctgggaatttagc • 361 ccatgcagggggttccgttgatttaactattttttccctacatttagcaggtatttcctc • 421 gattttaggggctattaactttattacaacaattattaatatgaagccccccgccatttc • 481 tcaataccaaacccccttgtttgtgtggtccgtgttaattactgcagttctcctgcttct • 541 ttcactccctgtcttagctgctggtattacaatactcctcacggaccgaaatcttaacac • 601 caccttcttt gaccctgcag gaggggggga tcccatcctt taccaacacc tc • / – 2008 – validation (research) phase ~500,000 barcodes done? <100,000 barcodes visible – 2015 – production (genomics) phase ~6,000,000 barcodes done? ~5,000,000 barcodes visible? e.g., iBOL (see wiki postings): five years 5,000,000 specimens 500,000 species

  7. Christian Burks ________ CBurks@OntarioGenomics.ca www.OntarioGenomics.ca ________ iBOL (International Barcode of Life Project) www.DNAbarcoding.org

More Related