1 / 1

Understanding and Utilizing Minimal Promoter Sequences for Enhanced Gene Expression

Explore the significance of minimal promoter sequences for gene regulation and discover key transcription factors for optimal expression. Uncover insights into regulatory elements essential for gene function.

lenka
Télécharger la présentation

Understanding and Utilizing Minimal Promoter Sequences for Enhanced Gene Expression

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A P1 minimal promoter sequence -361 gctagcgccggcccgaggcttccccgcctgcgctccgggtcggagccactcaggcgcgtg-301 cgcgcgtggtctcgggccgacccgagtggccgggttctctgagctccaggcccccgccgc-241 cccctcccggctcccagccaacccgtccttccctttcctcacggaatgggtccggcgctg-181 ctcggggtcgcgcgccctggacccggctcgcgctcggtctcgcgctgtcagccgctgcct-121 ggctcgcgccgccttgcgctttccctcagtcagtggcgccgaaggctccgttaagcggcg-61 gccgcggttcctgtttccgtttcttcctctcccttcagtcgggagtagcatcctccaccc-1 cagcacccctcccactctcccggcgcggccagctgcagctgaaggcagcggctgtggcga60 cgggggacggcgccgatcg -183 ctt-181 gagggcagcttttctactcagccacccgtttgagtcctcaggttttgggatctggatccc-121 caggctacagggaagagttctgcacgggaagctcatcttccagcactctgattggccagt-61 tctcactccactcactggttttcccgctctgattggccccggtggcacccggccggcgac 1 tactttgtgtgccctggcggcgcggctgg - MZF1 - PAX5 - KLF15 - NFAT/IRF7/PU1 + MEIS1 - VMAF - IRF3/PRDM1 - VMYB + AREB6 + AREB6 - SPIB / IRF3 / NFAT / ELK1 - OLF1 - EVI1 - KLF15 + AP4 - KLF15 - PAX5 B P2 minimal promoter sequence - NKXH - MYB - Activator - CDP Protein 2 - HELT -YBXF + ETS1 + Gfi-1 + MEL1 - CDP + NKX3 + Gfi-1 + IKRS

More Related