lotus
Uploaded by
30 SLIDES
4088 VUES
710LIKES

cosmids

DESCRIPTION

cosmids. Cosmids are plasmid vectors that contain one or two “cos sites”. (The cos site and the length between 2 cos sites is the only requirement for DNA to be packaged into a phage particle). How do we clone DNA into a cosmid vector ? 1. We use a polylinker.

1 / 30

Télécharger la présentation

cosmids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. cosmids Cosmids are plasmid vectors that contain one or two “cos sites”.(The cos site and the length between 2 cos sites is the only requirement for DNA to be packaged into a phage particle).How do we clone DNA into a cosmid vector ? 1. We use a polylinker. 2. We package this DNA into phage particles like phage DNA. 3. We propagate the cosmid as a plasmid (a plasmid with a selecor gene). 4. We purify the cosmids as if they were plasmids. As the head of a phage can accept between 40 and 55 kb of DNA and as most cosmids are about 5 kb in length, between 33 and 48 kb of DNA can cloned in these vectors. -------------------------------Un cósmido es un plásmido en el cual se han clonado las secuencias cos necesarias para la encapsulación de partículas de fago lambda. Un cósmido presenta las 5 características siguientes: un gen de resistencia a uno ó más antibióticos un orígen de replicación de plásmido una sitio de clonaje una ó dos secuencias cos una talla pequeña : alrededor de 5 kb

  2. This cosmid is cut at a BglII site next to the cos site.Donor genomic DNA is cut using Sau3A, which gives sticky ends compatible with BglII.Fragment are treated with alcaline phosphatase.A tandem array of donor and vector DNA results from mixing.DNA is packaged as for the phage.http://www.fmv.ulg.ac.be/genmol/MODGEN/ChapterIII/Fig14_9.htm

  3. from:http://www.bi.umist.ac.uk/users/mjfssps/2GEN/Cosmid2.htmfrom:http://www.bi.umist.ac.uk/users/mjfssps/2GEN/Cosmid2.htm

  4. SuperCos 1 Cloning Site Region(sequence shown 1–71) BamH EcoR I Not I T3 PromoterT7 Promoter Not I EcoR I gaattcgcggccgcaattaaccctcactaaagggatccctatagtgagtcgtattatgcggccgcgaattc cos site recognition: l-Terminase is an endonuclease that recognizes a sequence of about 100 bp at the cos region of the l genome. It cleaves in this region to generate termini with complementary 12base, 5'-overhangs. l-Terminase is the product of the A and Nu1 genes of bacteriophage l,and is involved in the resolution of concatemeri cgenomes during the phage assembly process. This enzyme is a heteromeric protein possessing several activities including DNA binding, nicking of the DNA at the cos site and dissociationof the cohesive ends. ATP serves as a requiredcofactor for l-Terminase activity. While only the binding of ATP is necessary for cos sitenicking, ATP hydrolysis is necessary for cohesiveend dissociation.

  5. fosmide Fosmids are similar to cosmid vectors in that they contain cohesiveend sites (cos) for bacteriophage packaging of cloned DNA inserts 35-45 kb in size. However, like BACs,fosmids are derived from geneticelements of the single copy fertility(F) factor of E. coli, which enables fosmids to maintain genomic DNA inserts with much higher stability than cosmids.

  6. Artificial chromosomes Rice has a genome size of 430 Mbwhich is the smallest among the major cereal crops such as maize, barley and wheat. It is also considered to be a model cereal because of its synteny with other cereal genomes.In Japan, the Rice Genome Research Program (RGP) was launched in 1991 to characterize the genomic structure of rice which is fundamental in understanding its function as well. During the first 7 years of RGP, we analyzed about 29000 cDNA clones of Oryza sativa ssp. japonica variety, Nipponbare and constructed a 2275-marker genetic map from a cross between the japonica variety, Nipponbare and the indica variety, Kasalath. A comprehensive analysis of the structure and organization of the complex genome of rice requires techniques that permit cloning and handling of large DNA fragments. Essentially, two host systems namely, Saccharomyces cerevisiae and Escherichia coli have been developed for this purpose. YACs, PACs and BACs YACs: Extremely large DNA molecules (up to more than 1 Mb) can be introduced and propagated in the form of yeast artificial chromosomes (YACs) in S. cerevisiae. BACs and PACs: Alternatively, the P1 phage, bacterial artificial chromosomes (BACs) and P1-derived artificial chromosomes (PACs) cloning systems developed for E. coli that could introduce of cloning DNA fragment size of 80-350 kb. For rice, it is thus most practical to use YACs for construction of physical maps in order to represent the entire genome as contiguous sets of overlapping clones as well as for the application in map-based cloning of agronomically important genes n this respect, we constructed a rice genomic library of japonica variety, Nipponbare by YACs.

  7. This library was then used for the construction of a YAC-based physical map using DNA markers on the genetic map (Kurata et al. 1997, Saji et al. 1999) covering about 70 % of rice genome. Although the YAC system has been used for other genomes as well, several limitations such as the frequent occurrence of chimeric clones (Green et al. 1991), instability of cloned fragments (Neil et al. 1990) and the relatively laborious procedures required for the purification of the cloned DNA, fostered the establishment of the E. coli cloning systems (Monaco and Larin 1994). Accordingly, the strong efforts devoted toward the detailed analysis of the Oryza sativa genome, particularly toward its entire sequencing project started from 1998 (Sasaki 1998), created a strong demand for high-quality PAC or BAC libraries. Two Oryza sativa BAC libraries from indica variety, IR-BB21 (Guo et al. 1995) and japonica variety, Shimokita (Nakamura et al. 1997) have been established for gene cloning experiments. Based on the insert size and number of

  8. PAC 1 Construction and Characterization of Rice Genomic Libraries: PAC ...Construction and Characterization of Rice Genomic Libraries: PAC Library of Japonica Variety, Nipponbare and BAC Library of Indica Variety, Kasalath.A P1-derived artificial chromosome (PAC) library and a bacterial artificial chromosome (BAC) library have been established for Oryza sativa ssp. japonica variety, Nipponbare and Oryza sativa ssp. indica variety, Kasalath, respectively. These libraries are referred to as the RGP (Rice Genome Research Program) Nipponbare PAC library and the RGP Kasalath BAC library.

  9. The PAC library has a coverage of about 16 genome equivalents and consists of 69276 recombinant clones carrying inserts (generated by partial Sau 3AI digestion) with an average size of about 112 kb in a PAC vector, pCYPAC2. Hybridization with organellar DNA revealed the presence of 11.8 % clones with chloroplast DNAand 0.9 % clones with mitochondrial DNA.On the other hand, the BAC library has a coverage of about 14 genome equivalents and consists of 47194 recombinant clones carrying inserts (generated by partial MboI digestion)of an average size of about 133 kb in a BAC vector, pBeloBAC11.Hybridization with organellar DNA revealed the presence of 2.5 % clones with chloroplast DNA and 0.6 % clones with mitochondrial DNA.With extensive genome coverage, these libraries provide excellent resources for genome analysis such as genetic mapping, map-based gene cloning, and genome sequencing of the two major subspecies of rice. A Hind III total and partial digestion

  10. PAC 2 A 7.5 Mb Sequence-Ready PAC Contig and Gene ExpressionMap of Human Chromosome 11p13–p14.1Beate Gawin,1 Alexandra Niederführ,1 Nina Schumacher,1 Holger Hummerich,2 Peter F.R. Little,2 and Manfred Gessler1. 1Physiologische Chemie I, Biozentrum der Universität Würzburg, Am Hubland, D-97074 Würzburg, Germany; 2Departmentof Biochemistry, Imperial College of Science, Medicine and Technology, London SW7 2AZ

  11. Figure 1 PAC contig covering 7.5 Mb of 11p13–14.1.201 PAC clones are displayed, represented by horizontal bars with clone names (original well location) written above and insert sizes in kb below.).

  12. PACs drawn as light grey horizontal bars between CAT and PAX6 are from the PAC contigdescribed previously in Niederfu¨hr et al. (1998). Square boxes at the ends of most clones alludeto the SP6 (empty box) and the T7 ends (filled box) that have been used for hybridization analysis.Every PAC clone crossing a presumed verticalline through these boxes had shown a positive hybridization signal with the respective end probe and was thus proven to overlap. At the PAX6 locus several cosmid clones are shown that have been sequenced previously by the Sanger Centre (GenBank accession nos. Z83301, Z83306-83309, Z86001, and Z95332). The horizontal line on top of the contig represents the integrated map of 11p13–14.1 with known markers and NotI restriction sites that are indicated by tick marks. Genes are highlighted by shaded boxes and the newlyintegrated EST clones are written at a 45° angle. The positions of RAG1/2 and TRAF6 as well as of the three EST clones 60587, 125727, and 41188, have been determined byhybridization to YAC clones located at the centromeric border of 11p13.

  13. BAC An exercise: Construction and characterization of a bacterial artificial chromosome libraryof Arabidopsis thaliana. Sangdun Choi, Robert A. Creelman, John E. Mullet, Rod A. Wing* Crop Biotechnology Center. Texas A&M University, College Station, TX 77843 *author for correspondence (email address): rodwing@tam2000.tamu.eduhttp://weedsworld.arabidopsis.org.uk/Vol2/choi.html Abstract We constructed an ordered 3,948 clone Arabidopsis BAC library.The library has a combined average insert size of 100 kb (n=54). Assuming a haploid genome size of 100,000 kb, the BAC library contains 3.95 haploid genome equivalents with a 98% probability of isolating a specific genomic region. The library was screened with five Arabidopsis cDNA probes and one tomato probe and all probes hybridized to at least one (in most cases three) BAC clones in the library.

  14. Introduction The technique of chromosome walking provides a means of cloning any gene identified by mutational analysis. Arabidopsis thaliana is the best plant system to utilize this technique because of its small genome size, low repetitive DNA content, availability of a dense genetic map and existence of a large number of mapped probes.In order to facilitate chromosome walking, libraries of the Arabidopsis genome have been constructed using yeast artificial chromosome (YAC) vectors (summarized in Gibson and Somerville, 1992). The primary advantage of YACs is the potential for cloning large insert sizes (ranging from 100 to 150 kb for A. thaliana "abi1", "U", and "EW" libraries) Despite the successes of the YAC vector cloning system, many problems exist which include chimerism and tedious steps in the manipulation and isolation of YAC insert DNA. Utilizing an F factor derived cloning system, bacterial artificial chromosome (BAC) vectors have been used to clone human DNA with inserts as large as 300 kb and plant, DNA with inserts averaging 157 and 140 kb, respectively.BACs are maintained as single copy plasmids in E. coli and exclude other BAC plasmids from replicating in the same host cell. Advantages of BACs over YACs include lower levels of chimerism and ease of library generation and insert manipulation. Techniques also exist to isolate the proximal ends of fragments inserted into the BAC vector. In this report, we describe the construction and characterization of an A. thaliana BAC library.

  15. Materials and Methods Plant Material Arabidopsis thaliana ecotype Columbia was grown in soil at 22 C under short days (11 h light) for 3 to 5 weeks. BAC Library Construction and Characterization Megabase size DNA was prepared from A. thaliana nuclei embedded in agarose microbeads as described (Zhang et al., 1995). Size selection of a HindIII partial digest was carried out in a 1% low melting point agarose gel at 4.0 V/cm with a 5 second pulse for 10 h at 11 C° and ligated to dephosphorylated pBeloBAC11 (Woo et al., 1994). Ligation material was used to transform DH10B (BRL) using a BRL Cell-Porator system (Woo et al., 1994). Transformed cells were resuspended in SOC*, incubated at 37 C for one h, and plated onto LB agar containing 12.5 mg/ml chloramphenicol, 0.5 mM IPTG and 40 mg/ml X-Gal (screening).*S.O.C. medium: 2% Bacto tryptone, 0.5% Bacto Yeast Extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose, pH 7.0

  16. Size selection of a HindIII partial digest was carried out in a 1% low melting point agarose gel at 4.0 V/cm with a 5 second pulse for 10 h at 11 C°

  17. The Hind III digest were ligated to dephosphorylated pBeloBAC11 (after this BAC was open by Hind III) pBeloBAC11 represents the second generation BAC cloning vectors. It introduces the LacZ gene to facilitate recombinant identification with blue and colorless (white) phenotypes. The T7 and SP6 promoters facilitate the Generatiion of RNA probes for chromosome walking and DNA sequencing. The G + C rich restriction sites (Not I, Eag I, Xma I, Sma I, Bgl I, and Sfi I) can be used to excise the inserts ofBAC clones. There are two selective markers for cloning purposes: LacZ gene for recombinant selection and CMR (chloramphenicol) for transformant selection. The F factor codes for genes that regulate its own replication and controls its copy number. The genes oriS and repE mediate the unidirectional replication of the F factor, and the parA and parB maintain copy number at a level of one or two per cell.

  18. Transformed cells were resuspended in SOC, incubated at 37 C for one h, and plated onto LB agar containing 12.5 mg/ml chloramphenicol, 0.5 mM IPTG and 40 mg/ml X-Gal (screening).

  19. White colonies were transferred to microtiter plates containing LB freezing buffer (Woo et al., 1994), incubated at 37C for 24 h and then stored at -80 C.Recombinant BAC DNA Isolation, Restriction, and CHEF Analysis BACs containing A. thaliana DNA were isolated from 5 ml overnight cultures (LB plus 12.5 mg/ml chloramphenicol) using standard alkaline lysis procedures and resuspended in TE. BAC DNA was digested with NotI to free the genomic DNA from the 7.4 kb vector. The digested DNA was separated by electrophoresis in a 1% agarose gel in 0.5x TBE at 11 C using a Bio-Rad CHEF Mapper set at 6 v/cm with a linear pulse time ramping from 5 to 15 s for 16 h.

More Related