280 likes | 432 Vues
Transcriptome analysis of the TnrA regulon in Bacillus subtilis. Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark. Bacillus subtilis.
E N D
Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark
Bacillus subtilis • Bacillus means rod-shaped bacteria. The rod in the gut was Bacillus coli and the rod found in rotting hay was Bacillus subtilis • Louis Pasteur used heat-attenuated Bacillus anthracis as the first anti-bacterial vaccine • Subtilis means: highly sensitive – weak – mild (subtle) • Soil bacteria typically found in association with plants
Bacillus subtilis Bacillus subtilis • B. subtilis has been used for studying different systems: gene regulation, metabolism and differentiation • The second most extensively studied bacteria • The first to be transformed in the laboratory. This process was optimized by Anagnostopoulos and Spizizen in 1961
Bacillus subtilis Bacillus subtilis • Fully sequenced and has around 4,225 predicted genes (SubtiList, R16.1) • Non-hasardous • Easy to grow and manipulate genetically • Sporulates • Secretes proteins • Of extensive interest to industry
NH4+ + glutamate glutamine Glutamine synthetase
Access to nitrogen through alternative pathways gltAB gabP nasA pucR ykzB-ykoL nasABCDEF nrgAB ansZ ycs-kip pucABCDE glnR glnA GlnA - Glutamine Synthetase GlnR TnrA tnrA ureA ureB ureC
NH4/glutamate wildtype versus wildtype in different media Allantoin Glutamate Glutamine wildtype versus mutant in the same medium TnrA GlnA GlnR
TnrA ALLANTOIN N H 2 A d e n i n e N O u t I n N H H N N H H O 2 A d e n i n e d e a m i n a s e ( a d e C ) N H 3 O H y p o x a n t h i n e N I n O u t H N H H N N H p b u G O 2 X a n t h i n e d e h y d r o g e n a s e ( p u c A B C D E ) H O 2 2 O O X a n t h i n e G u a n i n e N N G u a n i n e d e a m i n a s e ( g d e ) H N I n O u t H N O u t I n H H N N O N N H H O N H N H H 3 2 2 H p b u G X a n t h i n e O 2 p e r m e a s e X a n t h i n e d e h y d r o g e n a s e ( p u c A B C D E ) ( p b u X ) H O 2 2 O U r i c a c i d 2 N H + C O H 3 2 N H N O u t I n O N O N U r e a s e ( u r e A B C ) H O H 2 H O U r i c a c i d 2 p e r m e a s e U r i c a s e ( p u c L M ) ( p u c J K ) U r e a G l y o x y l i c a c i d C O 2 O O H H N 2 A l l a n t o i n O H + N H N O u t I n 2 O H O N H O 2 N H O N H H U r e i d o g l y c o l a s e ( p u c G ) A l l a n t o i n O 2 p e r m e a s e A l l a n t o i n a s e ( p u c H ) ( p u c I ) C O 2 U r e i d o g l y c i n e U r e i d o g l y c o l i c a c i d A l l a n t o i c a c i d O O H O O H O O H A l l a n t o a t e A l l a n t o a t e O u t I n H N N H H N H N 2 2 2 a m i d o h y d r o l a s e ( p u c F ) a m i d o h y d r o l a s e ( p u c F ) 2 N H H H O H O N N O O N H 2 O N N H + C O H O H O N H H H H 3 2 2 2 3 A l l a n t o i n p e r m e a s e ( p u c I ) Purine catabolism PucR Pathway specific regulator of purine catabolism
REFERENCE SAMPLE mRNA mRNA cDNA cDNA Cy5-cDNA Cy3-cDNA
B. subtilis microarrays • PCR products from ~97% of all genes • spotted onto poly-L-lysine coated glass microscope slides using a 16-pin microarrayer • Hybridized to Cy3 and Cy5 labeled first-strand cDNAs • Scanned
NUMBERS: 2different growth experiments 3hybridizations (arrays) per culture 2spots per gene on each array 2 x 3 x 2 = 12intensities for each gene
RESULT: 6 lists Allantoin: 132 Glutamine: 60 Glutamate: 91 TnrA: 239 GlnA: 159 GlnR: 67
Extraction - Visualization • Extraction: The gene should be significantly affected in at least two of the six experiments (except “Glutamine”) • List of ~100 genes highly likely to be involved in the TnrA-GlnA system • Visualization: ClustArray
GlnR GlnA TnrA Glutamine Glutamate Allantoin Opposite expression profile – common TnrA regulated regulator? pucA yrbD nrgB nrgA pucJ hxlA ywpH pucL pucK ureC ureB gabP ywfM yhdG dppA pucB nasA nasE ykoL tnrA ysnE cotZ guaD Activated by TnrA or PucR?
What is the function of these genes ? yrbD: sodium/proton-dependent alanine carrier hxlA: 3-hexulose-6-phosphate synthase ywpH: single-strand DNA-binding protein ywfM: unknown yhdG: amino acid transporter dppA: D-alanyl-aminopeptidase ysnE:similar to acetyltransferase cotZ: spore coat protein
TnrA box = TGT.A.......T.ACA • Built aWeight Matrix from known sites • searched the upstream regions • sorted and extracted • clustered and displayed
braBglnR GlnR GlnA TnrA Glutamine Glutamate Allantoin GlnR GlnA TnrA Glutamine Glutamate Allantoin Repressed by TnrA ? Repressed by GlnR ? pucA yrbD nasA nrgA pucJ ykoL tnrA pucR ykzB yyaF pucH ywoE gabP yhdG ycsF yuiA yycB yodF gltA hisI yocR bioA Repressed by TnrA?
Experimental investigations TnrA activated genes? yrbD: similar to sodium/proton-dependent alanine carrier protein yhdG: similar to amino acid transporter yyaF: similar to GTP-binding protein yrbD and yhdG have the TnrA box in a plausible position
Experimental investigations TnrA repressed genes? yuiA: ?? yycB: similar to permease yodF: similar to proline permease hisI: phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATPpyrophosphohydrolase yocR: similar to sodium-dependent transporter bioA: adenosylmethionine-8-amino-7-oxononanoate aminotransferase
Experimental investigations GlnR repressed gene ? braB: branched-chain amino acid transporter A GlnR knockout with a braB-lacZ fusion do have higher -galactosidase activity than the wildtype .... and two putative binding sites
ureP3 gatgtgaataaatataacaaaaaaagaagctgatttggtcaaggtaactaaattttttaaatattctttgaattaataggcctcttctatataatgatgacataagttgtaaacttttataacatcat g cggtacaaggtatgatatttatgttaccataacaaaatttaatagaaaattacgaaaaactagtattgacttctaatttttttaccatataataagatttgttcgtttcgtcatattatctgacaatta braB TnrA box TnrA box -35 -10 +1 TnrA box TnrA box
ACTIVITY OF yhdG + N –N allantoinglutamine wildtype: 700 3.000 700 700 TnrA-mutant: 1.000 GlnA -mutant : 2.000 PucR -mutant : 3.000 2.000 Verified new discoveries: ureABC (urease operon) is activated by PucR yrbD and yhdG:activated by TnrArepressed by PucR
...more verified new discoveries • Compentence is induced in glutamate medium = one-step transformation procedure • A TnrA mutant has reduced competence ...only 2% of wildtype level • TnrA somehow regulates the development of competence
Acknowledgements Section of Molecular Microbiology - DTU: Hans Henrik Saxild Lars Beier Center for Biological Sequence analysis – DTU: Steen Knudsen Chris Workman (software) Laurent Gautier (statistics) The array group (discussions) Kristine Dahlin Novozymes Biotech Inc – Davis, California: Randy Berka Maria Tang Alan Sloma Department of Microbiology – Boston University: Susan Fisher Lewis Wray, Jr. Jaclyn Brandenburg
Todays exercise inferring regulatory networks
Experiment Gene TnrA GlnA GlnR nrgA -1 1 0 purE 1 -1 0 1 1 1 glnR
A B A B C C D D