1 / 10

Macugen ( pegaptanib )

Macugen ( pegaptanib ). Treats wet age-related macular degenration Pegylated nucleic acid Antiangiogenic : Stops vascular overgrowth Other options, but does not reverse Avastin (colon cancer drug) Lucentis (can actually restore vision—more common). Macugen – Macular Deneration.

malini
Télécharger la présentation

Macugen ( pegaptanib )

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Macugen (pegaptanib) • Treats wet age-related macular degenration • Pegylated nucleic acid • Antiangiogenic: Stops vascular overgrowth • Other options, but does not reverse • Avastin (colon cancer drug) • Lucentis (can actually restore vision—more common)

  2. Macugen – Macular Deneration • wet Age-Related Macular Degeneration (ARMD) • Overexpression of protein VEGF 165: Vascular Endothelial Growth Factor • → vasculature crowds out photoreceptors

  3. Macugen – Active Ingredient • Aptamer – Anti-VEGF nucleic acid (50 kilodaltons) • (CGGAAUCAGUGAAUGCUUAUACAUCCG) • Binds to VEGF, preventing function (similar to other antiangiogenics; different molecule class)

  4. Macugen – Active Ingredient • ((2'-deoxy-2'-fluoro)C-Gm-Gm-A-A-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-Am-Gm-(2'-deoxy-2'-fluoro)U-Gm-Am-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Gm-(3'→3')-dT), 5'-ester with α,α'-[4,12-dioxo-6-[[[5-(phosphoonoxy)pentyl]amino]carbonyl]-3,13-dioxa-5,11-diaza-1,15-pentadecanediyl]bis[ω-methoxypoly(oxy-1,2-ethanediyl)], sodium salt.

  5. Macugen – Treatment • Technique: • Local anesthetic and antimicrobial • Intravitreal injection (“slight pressure”, but no pain) • Dose: 0.3 mg (1.6 mg pegylated) • Volume: 90 µL (pre-filled syringe) • Short-term effects • Cloudy vision • Tiny air bubble in eye • Itchiness/soreness

  6. Macugen – Formulation • Drug provided as sodium salt • Coated in polyethylene glycol to reduce immune response and size in solution • Inactive ingredients: • , (Counterions for drug/salt) • /(pH adjustment)

  7. Macugen – How Does It Work? Vascular Endothelial Growth Factor (VEGF): a signal protein that stimulates vasculogenesis and angiogenesis. Angiogenesis:the physiological process involving the growth of new blood vessels from pre-existing vessels.

  8. Macugen – History • Discovered by Gilead Sciences • Liscensed to EyeTech Pharmaceuticals (Now OSI Pharmaceuticals) for late stage development and marketing in the U.S. • Marketed by Pfizer outside of the U.S. • Approval Granted by the U.S. Food and Drug Administration (FDA) in December, 2004.

  9. Macugen – Deficiencies • Serious side effects may include detached retinas, endophthalmitis(< 1%) • Less serious side effects include eye floaters, discomfort, slightly increased intravitrealpressure, infection, or allergic reaction(≤ 40%)

  10. Macugen – Alternative Therpies • Implantable Telescope • Lucentis • Avastin • Visudyne Drug Treatment or Photodynamic Therapy (PDT) • Laser Treatment

More Related