marvela
PRESENTED BY
67 SLIDES
1.14K VUES
690 LIKES

Bioinformatics

DESCRIPTION

Bioinformatics. مهدی صادقی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری مركز تحقيقات بيوشيمي-بيوفيزيك ؛ دانشگاه تهران. Bioinformatics is interdisciplinary . Computer Science. Biology. Information Management. Biochemistry. Molecular Biology. Bioinformatics. Theoretical CS.

1 / 67

Télécharger la présentation

Bioinformatics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Bioinformatics مهدی صادقی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری مركز تحقيقات بيوشيمي-بيوفيزيك ؛ دانشگاه تهران

  2. Bioinformatics is interdisciplinary Computer Science Biology Information Management Biochemistry Molecular Biology Bioinformatics Theoretical CS Machine Learning Data Mining Biophysics Applied Mathematics & Statistics

  3. bio – informatics: bioinformatics is conceptualizing biology in terms of molecules (in the sense of physical chemistry) and applying “informatics techniques” (derived from disciplines such as applied maths, computer science and statistics) tounderstandandorganizetheinformationassociated with these molecules, on alarge scale.In short, bioinformatics is a management information system for molecular biology and has manypractical applications.

  4. DNA RNA PROTEIN SEQ PROTEIN STRUCT PROTEIN FUNCTION ………. Flow of information

  5. Eukaryotic

  6. transcription

  7. Reading the Genetic Code • THREE nucleotides is a CODON

  8. Amino Acids

  9. genome protein

  10. Protein structures are depicted in a variety of ways Backbone only Ribbon Space-filling Space-filing, With surface charge Blue = negative charge Red = positive

  11. Recent Trend • A great surge in genomics • The Human Genome Project • Genome projects for ~400 organisms • >1000 completed published genomes • Recent advances in molecular genetics technologies, especially microarrays • Push to analyze genes and gene products, and to determine protein structure/function relationship • High through-put biology, large scale data analysis

  12. Aims of bioinformatics • First Data organization researchers access to existing information submit new entries • Second develop tools and resources that aid in the analysis of data • Third interpret the results in a biologically meaningful manner.

  13. “… ORGANISE the information on a LARGE SCALE …”

  14. “…the INFORMATION associated with these molecules…”

  15. General Types of “….Informatics techniques…..” • Geometry • Robotics • Graphics (Surfaces, Volumes) • Comparison and 3D Matching (Vision, recognition) • Physical Simulation • Newtonian Mechanics • Electrostatics • Numerical Algorithms • Simulation • Databases • Building, Querying • Object DB • Text String Comparison • Text Search • 1D Alignment • Significance Statistics • Finding Patterns • AI / Machine Learning • Clustering • Datamining

  16. Bioinformatcs Tools and Services Databases: text, sequence, structure • Database annotation text searches • Sequence similarity search tools • Gene finding • Sequence and structure analysis tools • Structure prediction tools • 3D structure visualization tools • Phylogenetic analysis tools • Metabolic analysis tools

  17. Sequence comparison: Gene sequences can be aligned to see similarities between gene from different sources 768 TT....TGTGTGCATTTAAGGGTGATAGTGTATTTGCTCTTTAAGAGCTG 813 || || || | | ||| | |||| ||||| ||| ||| 87 TTGACAGGTACCCAACTGTGTGTGCTGATGTA.TTGCTGGCCAAGGACTG 135 . . . . . 814 AGTGTTTGAGCCTCTGTTTGTGTGTAATTGAGTGTGCATGTGTGGGAGTG 863 | | | | |||||| | |||| | || | | 136 AAGGATC.............TCAGTAATTAATCATGCACCTATGTGGCGG 172 . . . . . 864 AAATTGTGGAATGTGTATGCTCATAGCACTGAGTGAAAATAAAAGATTGT 913 ||| | ||| || || ||| | ||||||||| || |||||| | 173 AAA.TATGGGATATGCATGTCGA...CACTGAGTG..AAGGCAAGATTAT 216

  18. Dynamic Programming:Global Alignment

  19. Multiple sequence alignment: Sequences of proteins from different organisms can be aligned to see similarities and differences

  20. Three sequence recurrence relation S(i,j,k) = max[S(i-1, j-1, k-1) + m(i,j) + m(i,k) + m(j,k), S(i-1, j-1, k) + m(i,j) + g, S(i-1, j, k-1) + m(i,k) + g, S(i, j-1, k-1) + m(j,k) + g, S(i-1, j, k)+ g + g, S(i, j-1, k) + g + g, S(i, j, k-1) + g + g] m(i,j) = similarity matrix eg BLOSUM g = gap penalty

  21. Dynamic programming time increases exponentially • Clearly, for N sequences, each sequence Li characters long, the time required will be N O( P Li ) i=1 This is exponential - O( LN ) We need to fill out each ‘box’ in the grid

  22. Major Application

  23. Finding Regulatory Motifs in DNA Sequences

  24. Motifs and Transcriptional Start Sites ATCCCG gene TTCCGG gene ATCCCG gene gene ATGCCG gene ATGCCC

  25. Motif Logo • Motifs can mutate on non important bases • The five motifs in five different genes have mutations in position 3 and 5 • Representations called motif logosillustrate the conserved and variable regions of a motif TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA

  26. Random Sample atgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggcataaggtacatgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtccacttataggtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttctgggtactgatagca

  27. Implanting Motif AAAAAAAGGGGGGG atgaccgggatactgatAAAAAAAAGGGGGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataAAAAAAAAGGGGGGGatgagtatccctgggatgacttAAAAAAAAGGGGGGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgAAAAAAAAGGGGGGGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAAAAAAAAGGGGGGGcttataggtcaatcatgttcttgtgaatggatttAAAAAAAAGGGGGGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtAAAAAAAAGGGGGGGcaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttAAAAAAAAGGGGGGGctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatAAAAAAAAGGGGGGGaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttAAAAAAAAGGGGGGGa

  28. Where is the Implanted Motif? atgaccgggatactgataaaaaaaagggggggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataaaaaaaaagggggggatgagtatccctgggatgacttaaaaaaaagggggggtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaataaaaaaaagggggggcttataggtcaatcatgttcttgtgaatggatttaaaaaaaaggggggggaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtaaaaaaaagggggggcaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttaaaaaaaagggggggctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcataaaaaaaagggggggaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttaaaaaaaaggggggga

  29. Implanting Motif AAAAAAGGGGGGG with Four Mutations atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGatgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttataggtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa

  30. Where is the Motif??? atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcgggatgagtatccctgggatgacttaaaataatggagtggtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttataggtcaatcatgttcttgtgaatggatttaacaataagggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttaaaaaatagggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatactaaaaaggagcggaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttactaaaaaggagcgga

  31. Why Finding (15,4) Motif is Difficult? atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGatgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccgagctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttataggtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaacggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaagctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa AgAAgAAAGGttGGG ..|..|||.|..||| cAAtAAAAcGGcGGG

  32. Challenge Problem • Find a motif in a sample of - 20 “random” sequences (e.g. 600 nt long) - each sequence containing an implanted pattern of length 8, - each pattern appearing with 2 mismatches as (8,2)-motif.

  33. Identifying Motifs: Complications • We do not know the motif sequence • We do not know where it is located relative to the genes start • Motifs can differ slightly from one gene to the next • How to discern it from “random” motifs?

  34. The Motif Finding Problem (cont’d) • The patterns revealed with no mutations: cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc acgtacgt Consensus String

  35. The Motif Finding Problem (cont’d) • The patterns with 2 point mutations: cctgatagacgctatctggctatccaGgtacTtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatCcAtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtTAgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtCcAtataca ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaCcgtacgGc Can we still find the motif, now that we have 2 mutations?

  36. Defining Motifs • To define a motif, lets say we know where the motif starts in the sequence • The motif start positions in their sequences can be represented as s = (s1,s2,s3,…,st)

  37. a G g t a c T t C c A t a c g t Alignment a c g t T A g t a c g t C c A t C c g t a c g G _________________ A3 0 1 0 31 1 0 ProfileC24 0 0 14 0 0 G 0 1 4 0 0 0 31 T 0 0 0 5 1 0 14 _________________ Consensus A C G T A C G T Line up the patterns by their start indexes s = (s1, s2, …, st) Construct matrix profile with frequencies of each nucleotide in columns Consensus nucleotide in each position has the highest score in column Motifs: Profiles and Consensus

  38. Consensus • Think of consensus as an “ancestor” motif, from which mutated motifs emerged • The distance between a real motif and the consensus sequence is generally less than that for two real motifs

  39. Consensus (cont’d)

  40. Evaluating Motifs • We have a guess about the consensus sequence, but how “good” is this consensus? • Need to introduce a scoring function to compare different guesses and choose the “best” one.

  41. Defining Some Terms • t - number of sample DNA sequences • n - length of each DNA sequence • DNA - sample of DNA sequences (t x n array) • l - length of the motif (l-mer) • si - starting position of an l-mer in sequence i • s=(s1, s2,… st) - array of motif’s starting positions

  42. Parameters DNA l= 8 cctgatagacgctatctggctatccaGgtacTtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatCcAtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtTAgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtCcAtataca ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaCcgtacgGc t=5 n = 69 s1= 26s2= 21s3= 3 s4= 56s5= 60 s

More Related