1 / 9

…ITK K GKY L T YEL…

Re-specification of I-AniI towards mouse g c-locus (X-SCID) 5’- TGAGGAGGTTTCTCTGTAAA -3’ 5’-AAG G A AGG C TTCTCTGTAAC -3’ 5’-AAG GGAGGTTTCTCTGTAAC -3’. WT. SCID. -10A -9A -8G. “2 nd shell” library. 109. 111. 112. 115. … LSG I I SL ED L PDY …. …LSG X I XX ED X PDY…. 160,000.

maxwell-rasmussen
Télécharger la présentation

…ITK K GKY L T YEL…

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Re-specification of I-AniI towards mouse gc-locus (X-SCID) 5’-TGAGGAGGTTTCTCTGTAAA-3’ 5’-AAGGAAGGCTTCTCTGTAAC-3’ 5’-AAGGGAGGTTTCTCTGTAAC-3’ WT SCID -10A -9A -8G “2nd shell” library 109 111 112 115 …LSGIISLEDLPDY… …LSGXIXXEDXPDY… 160,000 loop randomization 24 25 26 27 28 29 …ITKKGKYLTYEL… …ITKNXXXL/V/IR/KYEL… 24,000 4 x 109

  2. Isolating variants which cleave -10A -9A -8G expression/folding catalysis

  3. Catalytic specificity of variants on the K24N/T29R background 1 – GWWI TLYL 10 – GCYL LYYI 2 – ARWV ILWL 11 – GRYL KLIL 4 – GVIY MYIL 17 – GRYL VHLM 8 – GRYV VTWM

  4. Catalytic specificity of variants on the K24N/T29K background 1 – VKWV LLWM 5 – RRWL VLSL 9* – RIWV CYWL 2 – RLAV LRWL 6 – GAYL AKAV 10 – AFHL LRYL 3 – KRWV WRAV 7 – GDWV LRSR 11 – NMWI ARWT 4 – KIYI PKYL 8 – GKFV WLWV Random Ani WT -10-9-8

  5. 2-parameter selection to achieve catalytic specificity

  6. Catalytic specificity of variants selected against -9G 1 – GVWV WRHF 6 – RVYL LYFL 11 – GIYI LYLL 2 – GIWV LYSL 7 – GFYL LIYL 12 – RIWV CYWL 3 – YAYI IMHL 8 – LPYL ILAL 13 – HEYL RFFL 4 – LRYI CYWL 9 – THTL VYRL 14 – SKWL DLYL WT 5 – GIYL PRFM 10 – HAWL VRAR

  7. Building onto selected clones to target full mSCID site 5’-TGAGGAGGTTTCTCTGTAAA-3’ 5’-AAGGAAGGCTTCTCTGTAAC-3’ 5’-AAGGGAGGTTTCTCTGTAAC-3’ 2.94 x 109 per NK/NR clone

  8. Evaluating specificity interdependencies using fully randomized triplets Varied Position -10 -9 -8

  9. Evaluating interdependencies in clones which cut -10A -9A -8G NR clone#2 – ARWV ILWL NK clone#5 – RRWL VLSL

More Related