melva
Uploaded by
42 SLIDES
541 VUES
420LIKES

Exploring Ribosome Functionality: Insights from Recent Textbook Readings

DESCRIPTION

Join me on a journey through the intricate world of ribosome functionality as we review relevant textbook readings. Discover why ribosome structure reflects its function, and examine case studies that illustrate this relationship. You'll delve into topics such as mRNA processing, translation mechanisms, and the impact of mutations on genetic coding. Engage in active learning by answering thought-provoking homework questions designed to deepen your understanding. Let’s enhance our comprehension and appreciation of molecular biology together!

1 / 42

Télécharger la présentation

Exploring Ribosome Functionality: Insights from Recent Textbook Readings

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. So... why are you here?

  2. REU: Summer research in Malibu with pay $ Prof Peter Smith on Thursday, I’m traveling to a CF research conference. Exam II available for 7 days so far (since Tuesday) and due in 20 days, Nov 21st SALG feedback expires tonight, ec 2 points. Textbook Reading: today you were to read 7 pages on Translation, take notes, study them Announcements

  3. Our goals are not achieved by only reading or listening to a lecturer—you must actively do things in order to learn (Bio or Kung Fu)

  4. last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 7

  5. last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 8

  6. last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 9

  7. Ribosome mRNA Signal peptide ER membrane Signal peptide removed Signal- recognition particle (SRP) Protein CYTOSOL Translocation complex ER LUMEN SRP receptor protein

  8. last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 12

  9. last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 13

  10. DNA TRANSCRIPTION 3′ Poly-A RNA polymerase RNA transcript 5′ RNA PROCESSING Exon RNA transcript (pre-mRNA) Intron Aminoacyl-tRNA synthetase Poly-A NUCLEUS Amino acid AMINO ACID ACTIVATION CYTOPLASM tRNA mRNA Growing polypeptide 3′ Cap A Activated amino acid Poly-A P Ribosomal subunits E Cap 5′ TRANSLATION E A Anticodon Codon Ribosome

  11. What real use is such a detailed understanding of how the process of Transcription or Translation works? Why should I care?

  12. 1. siRNAs (small interfering, silencing) miRNAs (micro) RNA interference (RNAi)

  13. 2. Design and testing of antibiotics

  14. Azithromycin

  15. Zyvox (MRSA) methicillin-resistant Staphylococcus aureus (MRSA) vancomycin-resistant Enterococcus faecium (VRE)

  16. Test your knowledge • Identify the best answer

  17. Which of the following is NOT true of a codon? • It consists of three nucleotides. • It may code for the same amino acid as another codon. • It never codes for more than one amino acid. • It extends from one end of a tRNA molecule. • It is the basic unit of the genetic code.

  18. Which of the mutations would be most likely to have a harmful effect on an organism? • a base-pair substitution • a deletion of three nucleotides near the middle of a gene • a single nucleotide deletion in middle of intron • a single nucleotide deletion near the end of the coding sequence • a single nucleotide insertion downstream of, and close to, the start of the coding sequence

  19. Translation: 3 parts • Language (AUG!) • Translators (tRNA & synth) • Factory (Ribosome subunits)

  20. Language (AUG!) What words are hidden in this sentence? UUAAG IAUGI GGG I UAU I AAG I UCA I ACC I UUG A UUAAGAUGGGGUAUAAGUCAACCUUGA UUAAGAUGGGGUAUAAGUCAACCUUGA What additional information do you need? ?????????? ITHEI RED I DOG I ATE I THE I CAT I STOP Frameshift mutation (delete E in RED) ?????????? ITHEI RDD I OGA I TET I HEC I ATS I TOP

  21. Translators (tRNA & synth) • tRNA is a translator/transfers amino acids (Multiple types of RNA) • Aminoacyl-tRNA Synthetase (Charging enzyme loads aas on tRNAs)

  22. Charging Enzymes (aminoacyl tRNA synthetases)

  23. Factory (Ribosome subunits) • Small and large subunits (mix of protein & rRNA) • Large subunit contains different chambers (P-peptide, A-amino acid, E-exit) • Phases: Initiation, Elongation (3 steps),and Termination

  24. Initiation Large ribosomal subunit 3′ U 5′ C A P site Met Met 5′ 3′ A G U Initiator tRNA GDP GTP E A mRNA 5′ 5′ 3′ 3′ Start codon Small ribosomal subunit Translation initiation complex mRNA binding site

  25. Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ Elongation

  26. Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ GTP GDP Elongation E A P 2. Bond formation

  27. Fig. 17-18-3 Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ GTP GDP Elongation E A P 2. Bond formation E P A

  28. Fig. 17-18-4 Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site Ribosome ready for next aminoacyl tRNA 5′ GTP GDP Elongation E E P A A P GDP GTP 3. Translocation 2. Bond formation E P A

  29. Termination Release factor 3′ 5′ Stop codon (UAG, UAA, or UGA)

  30. Termination Release factor Free polypeptide 3′ 3′ 2 GTP 5′ 5′ Stop codon (UAG, UAA, or UGA) 2 GDP

  31. Termination Release factor Free polypeptide 5′ 3′ 3′ 3′ 2 GTP 5′ 5′ Stop codon (UAG, UAA, or UGA) 2 GDP

  32. Translation steps

More Related