Exploring Ribosome Functionality: Insights from Recent Textbook Readings
Join me on a journey through the intricate world of ribosome functionality as we review relevant textbook readings. Discover why ribosome structure reflects its function, and examine case studies that illustrate this relationship. You'll delve into topics such as mRNA processing, translation mechanisms, and the impact of mutations on genetic coding. Engage in active learning by answering thought-provoking homework questions designed to deepen your understanding. Let’s enhance our comprehension and appreciation of molecular biology together!
Exploring Ribosome Functionality: Insights from Recent Textbook Readings
E N D
Presentation Transcript
REU: Summer research in Malibu with pay $ Prof Peter Smith on Thursday, I’m traveling to a CF research conference. Exam II available for 7 days so far (since Tuesday) and due in 20 days, Nov 21st SALG feedback expires tonight, ec 2 points. Textbook Reading: today you were to read 7 pages on Translation, take notes, study them Announcements
Our goals are not achieved by only reading or listening to a lecturer—you must actively do things in order to learn (Bio or Kung Fu)
last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 7
last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 8
last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 9
Ribosome mRNA Signal peptide ER membrane Signal peptide removed Signal- recognition particle (SRP) Protein CYTOSOL Translocation complex ER LUMEN SRP receptor protein
last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 12
last night’s homework(why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 13
DNA TRANSCRIPTION 3′ Poly-A RNA polymerase RNA transcript 5′ RNA PROCESSING Exon RNA transcript (pre-mRNA) Intron Aminoacyl-tRNA synthetase Poly-A NUCLEUS Amino acid AMINO ACID ACTIVATION CYTOPLASM tRNA mRNA Growing polypeptide 3′ Cap A Activated amino acid Poly-A P Ribosomal subunits E Cap 5′ TRANSLATION E A Anticodon Codon Ribosome
What real use is such a detailed understanding of how the process of Transcription or Translation works? Why should I care?
1. siRNAs (small interfering, silencing) miRNAs (micro) RNA interference (RNAi)
2. Design and testing of antibiotics
Zyvox (MRSA) methicillin-resistant Staphylococcus aureus (MRSA) vancomycin-resistant Enterococcus faecium (VRE)
Test your knowledge • Identify the best answer
Which of the following is NOT true of a codon? • It consists of three nucleotides. • It may code for the same amino acid as another codon. • It never codes for more than one amino acid. • It extends from one end of a tRNA molecule. • It is the basic unit of the genetic code.
Which of the mutations would be most likely to have a harmful effect on an organism? • a base-pair substitution • a deletion of three nucleotides near the middle of a gene • a single nucleotide deletion in middle of intron • a single nucleotide deletion near the end of the coding sequence • a single nucleotide insertion downstream of, and close to, the start of the coding sequence
Translation: 3 parts • Language (AUG!) • Translators (tRNA & synth) • Factory (Ribosome subunits)
Language (AUG!) What words are hidden in this sentence? UUAAG IAUGI GGG I UAU I AAG I UCA I ACC I UUG A UUAAGAUGGGGUAUAAGUCAACCUUGA UUAAGAUGGGGUAUAAGUCAACCUUGA What additional information do you need? ?????????? ITHEI RED I DOG I ATE I THE I CAT I STOP Frameshift mutation (delete E in RED) ?????????? ITHEI RDD I OGA I TET I HEC I ATS I TOP
Translators (tRNA & synth) • tRNA is a translator/transfers amino acids (Multiple types of RNA) • Aminoacyl-tRNA Synthetase (Charging enzyme loads aas on tRNAs)
Factory (Ribosome subunits) • Small and large subunits (mix of protein & rRNA) • Large subunit contains different chambers (P-peptide, A-amino acid, E-exit) • Phases: Initiation, Elongation (3 steps),and Termination
Initiation Large ribosomal subunit 3′ U 5′ C A P site Met Met 5′ 3′ A G U Initiator tRNA GDP GTP E A mRNA 5′ 5′ 3′ 3′ Start codon Small ribosomal subunit Translation initiation complex mRNA binding site
Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ Elongation
Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ GTP GDP Elongation E A P 2. Bond formation
Fig. 17-18-3 Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site 5′ GTP GDP Elongation E A P 2. Bond formation E P A
Fig. 17-18-4 Amino end of polypeptide 1. Codon recognition E 3′ mRNA P site A site Ribosome ready for next aminoacyl tRNA 5′ GTP GDP Elongation E E P A A P GDP GTP 3. Translocation 2. Bond formation E P A
Termination Release factor 3′ 5′ Stop codon (UAG, UAA, or UGA)
Termination Release factor Free polypeptide 3′ 3′ 2 GTP 5′ 5′ Stop codon (UAG, UAA, or UGA) 2 GDP
Termination Release factor Free polypeptide 5′ 3′ 3′ 3′ 2 GTP 5′ 5′ Stop codon (UAG, UAA, or UGA) 2 GDP