The Gurdon Experiment: Uncovering Genetic Information in Cells
The Gurdon experiment investigates whether every cell in an organism contains the genetic instructions to develop into a complete individual. Through the use of enucleated eggs and donor nuclei, it highlights how genetic information is stored in DNA as sequences of bases and how this information is replicated during cell division by enzymes like DNA polymerase. Additionally, the experiment emphasizes the concepts of genes, proteins, and the Central Dogma of Biology (DNA → RNA → Protein), illustrating the universality of genetic code across organisms.
The Gurdon Experiment: Uncovering Genetic Information in Cells
E N D
Presentation Transcript
R R R R R R R r r r r r r r
The “Gurdon”experiment: Does every cell in an organism contain all the genetic information to make a complete individual?
Host egg Unfertilized egg Ultraviolet radiation of egg to destroy nucleus Enucleated egg
Host egg Donor nucleus
Host egg Donor nucleus
How is genetic information copied every time a cell divides? The two strands separate and each strand is used as a template for the synthesis of a new strand.
How is genetic information copied every time a cell divides? DNA polymerase is the enzyme (protein) that carries out DNA replication.
Bacteria have about 5 million basepairs of DNA. Bacteria can divide every 20 minutes. DNA polymerase replicates bacterial DNA at a rate of 4200 basepairs/second.
one gene one protein What is a gene? Genes are the basic units of inheritance. Genes are information to make proteins.
Most higher organisms have 15,000 - 35,000 different genes These organisms have the information (DNA) to make 15,000 - 35,000 different proteins
How is genetic information stored in DNA? As a sequence of bases (ATGCATTCGCAATT…)
The sequence of bases in DNA determines The sequence of amino acids in a protein determines The 3-D shape of the protein determines the sequence of amino acids in a protein. the 3-D shape of the protein. the function of the protein.
Genes are arranged on chromosomes like beads on a string DNA Gene 1 Gene 2 Gene 3 Gene 4 Gene 5
Humans have 23 pairs of chromosomes (46 total) Fruit Flies have 4 pairs of chromosomes (8 total) Arabidopsis has 5 pairs of chromosomes (10 total) Chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 A typical chromosome has thousands of genes
Protein 1 Protein 2 Protein 3 Protein 4 Protein 5 Genes code for proteins chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5
Transcription: DNA RNA nucleus cytoplasm DNA RNA
RNA is transported to cytoplasm cytoplasm nucleus DNA RNA RNA
Translation: RNA protein cytoplasm nucleus DNA RNA protein
DNA RNA protein cytoplasm nucleus DNA RNA RNA protein
Properties of DNA Double stranded Deoxyribonucleic acid Bases: A, G, C and T Properties of RNA Single stranded Ribonucleic acid Bases: A, G, C and U (U = uracil)
Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG
The code in RNA is read three bases at a time transcription translation
Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly
Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys
Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys - Gly
Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys - Gly Stop
AUG codes for the amino acid methionine in all organisms (bacteria, fungi, plants, and animals) GGC codes for the amino acid glycine in all organisms (bacteria, fungi, plants, and animals) The Genetic Code is Universal
The Genetic Code is Universal This fact proves one of Darwin’s most remarkable predictions: All life forms evolved from a common ancestor.
What is a mutation? A mutation is a change in the base sequence in DNA that results in a change in the amino acid sequence of a protein.
transcription transcription RNA … GGC UGU GGC UAG … GGC UAU GGC UAG translation translation Protein normal mutant … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC TAT GGC TAG … CCG ATA CCG ATC DNA … Gly - Cys - Gly Stop … Gly - Tyr - Gly Stop
ON OFF A gene is composed of two parts: regulatory region (on/off switch) coding region (codes for amino acids)
…AGCCTACCAAAAAAGGTTCCACG… …TCGGATGGTTTTTTCCAAGGTGC… Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA.
Some transcription factors are activators: • They turn genes ON. regulatory region (on/off switch) coding region (codes for amino acids)
Some transcription factors are activators: • They turn genes ON. - Some transcription factors are repressors: They turn genes OFF. regulatory region (on/off switch) coding region (codes for amino acids)