DNA Technology in Forensic Settings

1. DNA Technology in Forensic Settings http://learn.genetics.utah.edu/units/biotech/gel/

2. What is DNA? Deoxyribonucleic acid (DNA) is material that governs inheritance of eye color, hair color, stature, and many other traits Is unique for each individual except for identical twins

3. Chemical Structure of DNA

4. What is DNA composed of?

5. AATTGCCTTTAAAAT Way to describe a piece of DNA Possible for a DNA synthesizer to actually synthesize the same piece of DNA with this information alone The particular sequence of the DNA can code for many properties of the body�s cells. Large portions of our DNA are identical or very similar for all humans and we actually share a lot of the same DNA with all animals, even all plants and bacteria but certain portions of the DNA contain a lot of uniqueness among individuals Some DNA encodes for nothing that we know about, we call this junk DNA Possible for a DNA synthesizer to actually synthesize the same piece of DNA with this information alone The particular sequence of the DNA can code for many properties of the body�s cells. Large portions of our DNA are identical or very similar for all humans and we actually share a lot of the same DNA with all animals, even all plants and bacteria but certain portions of the DNA contain a lot of uniqueness among individuals Some DNA encodes for nothing that we know about, we call this junk DNA

6. Unless it has been purified, our DNA is actually not a loosely tangled string as illustrated but rather is well organized and packaged into what are called chromosomes. A chromosome is a tightly folded bundle of DNA. Chromosomes are most visible when cells divide. In a microscope, chromosomes look something like this without the numbers and letters: Unless it has been purified, our DNA is actually not a loosely tangled string as illustrated but rather is well organized and packaged into what are called chromosomes. A chromosome is a tightly folded bundle of DNA. Chromosomes are most visible when cells divide. In a microscope, chromosomes look something like this without the numbers and letters:

7. What are chromosomes? Bundled DNA when cells are getting ready to divide There are 23 pairs of chromosomes in human DNA including one pair of sex chromosomes Females two X chromosomesMale one X one Y Alleles variations on particular site on a chromosome If alleles are identical at a particular locus, person is homozygous for trait, if not person is heterozygous for trait What is a Chromosome? When a cell is getting ready to divide creating two daughter cells, it packs its DNA into bundles called chromosomes. Chromosomes are just bundles of DNA. For humans, there are consistently 23 pairs of chromosomes, each with a consistent size and shape. Chromosomes are numbered. Chromosome number 1 is the largest chromosome; chromosome number 2 a little smaller and so on. Among the 23 pairs of chromosomes there is a pair called the sex chromosomes. This is something of a misnomer, since there are many functions on the "sex" chromosomes that have nothing to do with sex. In females, the sex-chromosome pair consists of two similar size chromosomes called X chromosomes. Males have one X and one small Y chromosome What are alleles? Alleles (ALL-EELS') are just variations at a particular site on a chromosome. Since each chromosome has a similar chromosome partner (except for males with their X and Y chromosomes) each locus is duplicated. Loci can vary a bit. If a person has two identical versions of the locus, they are said to be homozygous (HOMO-Z-EYE'-GUS). If there is a difference, they are said to be heterozygous (HETERO-Z-EYE'-GUS). Example brown or blue eyes, right or left handed bring them into discussionWhat is a Chromosome? When a cell is getting ready to divide creating two daughter cells, it packs its DNA into bundles called chromosomes. Chromosomes are just bundles of DNA. For humans, there are consistently 23 pairs of chromosomes, each with a consistent size and shape. Chromosomes are numbered. Chromosome number 1 is the largest chromosome; chromosome number 2 a little smaller and so on. Among the 23 pairs of chromosomes there is a pair called the sex chromosomes. This is something of a misnomer, since there are many functions on the "sex" chromosomes that have nothing to do with sex. In females, the sex-chromosome pair consists of two similar size chromosomes called X chromosomes. Males have one X and one small Y chromosome What are alleles? Alleles (ALL-EELS') are just variations at a particular site on a chromosome. Since each chromosome has a similar chromosome partner (except for males with their X and Y chromosomes) each locus is duplicated. Loci can vary a bit. If a person has two identical versions of the locus, they are said to be homozygous (HOMO-Z-EYE'-GUS). If there is a difference, they are said to be heterozygous (HETERO-Z-EYE'-GUS). Example brown or blue eyes, right or left handed bring them into discussion

8. Quick Check DNA is composed of nucleotides that are joined together by covalent bonds between which two portions of each nucleotide? a. between deoxyribose and a phosphate group b. between the two deoxyribose groups c. between the nitrogen containing groups d. between a phosphate group and the nitrogen containing ring e. beween the phosphate groups of the two nucleotides Answer AAnswer A

9. Quick Check continued 2. In the hydrogen bonds between nitrogen containing bases ___________. a. A always pairs with C b. A always pairs with G c. C always pairs with T d. G always pairs with T e. G always pairs with C Answer EAnswer E

10. What does this have to do with forensic DNA testing? All DNA testing makes use of these properties of DNA to work Two main types: RFLP (Restriction fragment length polymorphism) STR (short tandem repeats) Both often make use of PCR (Polymerase chain reaction) RFLP also called DNA fingerprinting or DNA profilingRFLP also called DNA fingerprinting or DNA profiling

11. What is PCR? A way to increase the amount of DNA available for typing � does not actually type the DNA itself It amplifies the variable regions of DNA Allows old, damaged, or miniscule quantities to be used DNA has conserved and variable regions of DNA, the conserved are the same for every person and the variable differDNA has conserved and variable regions of DNA, the conserved are the same for every person and the variable differ

12. PCR Replicates like DNA does http://www.dnalc.org/ddnalc/resources/pcr.html Animation of PCR

13. PCR Contamination Can be a very serious problem A single piece of DNA can be amplified to billions of copies in 3 hours Contamination will nullify the evidence Proper quality control procedures must be in place

14. Read Part 1 of the Case of the Druid Dracula 1. DNA differences can be used to identify people. For example, there is a gene found on both the X and Y chromosomes called amelogenin, but the version of the gene found on the X and Y chromosomes differs in length, so it can be used to tell if a blood stain, such as the one found on the windowsill inside Mable Lyshon�s house, was left by a man or woman. This stretch of nucleotides shows one strand of the DNA double helix for the amelogenin gene; what is the sequence of the other complementary strand?5'CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3' a.3'ACTGTTAGATTTCCCTTTTTAGGTCTAGGTCCGTCGGCCTTATTTCCGAGGAATAA5' b.3'GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC5' c.5'GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC3' d.3'CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG5' e.5'CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3'

15. 2. To assist the investigators with the crime, you will need to perform Polymerase Chain Reaction (PCR) to create copies of this gene so the sizes can be compared to determine if the blood was from a man or woman. During PCR it will be necessary to break the hydrogen bonds of the base pairs. Where are those hydrogen bonds normally found? a.Between two nitrogen-containing bases in a single strand of DNA. b.Between the phosphate and sugar of the same nucleotide. c.Between the sugar of one nucleotide and the phosphate of a different nucleotide. d.Between one nitrogen-containing base on a single strand of DNA and another nitrogen-containing base on the complementary strand of DNA. e.Between one phosphate on a single strand of DNA and a sugar on the complementary strand of DNA.

16. 3. PCR creates copies of DNA using the exact same mechanism used by your cells to copy their own DNA (replication). Place the steps listed below in the order in which they occur during replication:A) two strands, one new and one original template, wind together to form the double helix.B) short stretch of primer (~20 nucleotides exactly complementary to the gene that is going to be copied) is made.C) separation of the double helix from two parental DNA strands.D) use of parental DNA as a template so that nucleotides are covalently bonded together to form a new chain that is complementary to the bases on the original template. a.) A, B, C, D b.) B, C, A, D c.) D, B, C, A d.) C, B, D, A

17. RFLP uses Requires more sample and fresh sample if used alone It examines more base pairs that have a high probability of being unique to individual Used in DNA lab coming up The test takes anywhere from 3 weeks to three months to complete, also. When a match is found, there is no question that the donor was at the scene of the crime. It�s very conclusive and finalizing. Unfortunately, the RFLP requires many sample cells from the crime scene like several strands of hair or large splatters of blood.When a match is found, there is no question that the donor was at the scene of the crime. It�s very conclusive and finalizing. Unfortunately, the RFLP requires many sample cells from the crime scene like several strands of hair or large splatters of blood.

18. How is RFLP done? 1. DNA from crime-scene evidence is cut with a restriction enzyme Restriction enzyme recognizes a particular short sequence of DNA that is likely to occur many times in a given cell�s DNA such as AATT In order for RFLP to work, the analyst needs thousands of cells. If all are present from a single individual, they will be cut in the same place.

19. How is RFLP done? (cont.) Cut DNA is sorted on gel by electrophoresis Gel allows small fragments to travel faster than large ones Location of DNA is visualized by staining or blotting Sizes of fragments are compared between different samples Certain DNA strands will have different sizes and random repeat sections based on gender. For example the amelogenin gene which codes for the enamel on teeth will be 112 base pairs long in males (AMELY) and only 106 base pairs long when it is on the x chromosome (AMELX)Certain DNA strands will have different sizes and random repeat sections based on gender. For example the amelogenin gene which codes for the enamel on teeth will be 112 base pairs long in males (AMELY) and only 106 base pairs long when it is on the x chromosome (AMELX)

20. RFLP Problemshttp://www.biology.arizona.edu/Human_bio/problem_sets/DNA_forensics_1/01Q.html Another example

21. What is STR? STR (short tandem repeats): Region of a DNA molecule that contains short segments that repeat over and over again The STR strand is short, less than 400 base pairs in length AGCTAGCTAGCTAGCT Short length makes the DNA less susceptible to degradation Their short length makes them ideal candidates for PCR, thereby overcoming the limited size of sample often encountered in crime scene samples Composed of junk DNA Strands are a lot shorter than found in typical RFLP proceduresComposed of junk DNA Strands are a lot shorter than found in typical RFLP procedures

22. How is STR done? The particular sequence sought is extracted and amplified from sample Sample is separated on gel The distance STR has migrated on gel correlates with number of repeats # of repeats individual has for particular locus will vary Frequency of STR sequences must be known for given population

23. How are the results of an STR analysis used? What is the likelihood that two, otherwise unrelated African-Americans would have the same TH01 signature? Same TH01 and TPOX? Same TH01, TPOX, and vWA? What certainty would you like to see in these numbers before you convict?

24. Which of the above (A or B) represents the profile of a man? Back to the Case of the Druid Dracula

25. Did suspect 1 or 2 commit the crime? suspect #1 suspect #2

26. 2. There are only a few different numbers of repeats that are seen in our population�only 5 different TPOX STRs for example. By testing thousands of DNA samples, researchers know the distribution of these different STRs in the general population; those allele frequencies are shown in the table below. Using these frequencies, one can determine the probability that someone else at random would have the same matching pattern. For example, what is the likelihood that someone else at random would have the same pattern of Matthew Hardman (a 5 and 7 repeat for the THO1 STR)? A.1/200 B. 1/206 C. 1/1200 D. 1/2600 E. 1/20060 Case Wrap Up I wrap up the case with a description of what really happened. During the arrest of Matthew Hardman, a knife was found in his coat pocket, but there was no visible blood on it. DNA testing of the damaged knife handle however revealed two sources of DNA, one matching Hardman and a partial profile matching the victim. In the meantime, further forensics work on the partial profile from the windowsill improved the discrimination to one in five million and finally to one in 73 million. The picture was complete when police searched Hardman�s home and found magazines as well as evidence the computer had been used to access Internet sites featuring vampires and how to become one. Matthew Hardman was found guilty of the murder of Mabel Leyshon at Mold Crown Court on August 2, 2002, and sentenced to life imprisonment.Case Wrap Up I wrap up the case with a description of what really happened. During the arrest of Matthew Hardman, a knife was found in his coat pocket, but there was no visible blood on it. DNA testing of the damaged knife handle however revealed two sources of DNA, one matching Hardman and a partial profile matching the victim. In the meantime, further forensics work on the partial profile from the windowsill improved the discrimination to one in five million and finally to one in 73 million. The picture was complete when police searched Hardman�s home and found magazines as well as evidence the computer had been used to access Internet sites featuring vampires and how to become one. Matthew Hardman was found guilty of the murder of Mabel Leyshon at Mold Crown Court on August 2, 2002, and sentenced to life imprisonment.

27. 3. What is the probability that someone else at random would have that same pattern of THO1 5 & 7, TPOX 8 & 9, and CSF1PO 11 & 12? a. 1/1600 b. 1/7200 c. 1/17600 d. 1/172800 e. 1/1555200

28. Mitochondrial DNA Found outside nucleus Inherited solely from mother Every cell contains hundreds to thousands of mitochondria therefore there are hundreds to thousands of copies of mtDNA in every cell vs. just one copy of nuclear DNA in each cell All discussion of DNA analysis up to this time has been about nuclear DNA, this is found in cell�s nucleus and is inherited from father and mother. Mitochondrial DNA is found outside nucleus in mitochondria and is inherited solely from mother. For someone who is long deceased and it is difficult to get a reference sample, it may be possible to get a reference sample from someone of the same maternal line. Its utility in forensic cases has been limited because it is much more difficult to do so not many labs are skilled enough also a database differentiating individuals is, at this time rather limited. All discussion of DNA analysis up to this time has been about nuclear DNA, this is found in cell�s nucleus and is inherited from father and mother. Mitochondrial DNA is found outside nucleus in mitochondria and is inherited solely from mother. For someone who is long deceased and it is difficult to get a reference sample, it may be possible to get a reference sample from someone of the same maternal line. Its utility in forensic cases has been limited because it is much more difficult to do so not many labs are skilled enough also a database differentiating individuals is, at this time rather limited.

29. Using DNA to Solve Crimes CODIS Combined DNA Index System: Allows investigators to compare DNA types recovered from crime scenes with DNA from convicted sex offenders and other criminals Has allowed thousands of crimes to be linked and solved Currently 13 STRs are encoded into CODIS Has allowed 373 case matches since its advent

30. Case study: Using mtDNA to establish identity in the case of Anastasia Romanov

31. Case Study: Two Peas in a Pod The Case of Questionable Twins