miller
Uploaded by
40 SLIDES
602 VUES
400LIKES

Today…

DESCRIPTION

Genome 351, 12 April 2013, Lecture 4. Today…. mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division. In bacteria (most) mRNAs are co-linear with their corresponding genes. Promoter. terminator. gene.

1 / 40

Télécharger la présentation

Today…

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genome 351, 12 April 2013, Lecture 4 Today… • mRNA splicing • Promoter recognition • Transcriptional regulation • Mitosis: how the genetic material is partitioned during cell division

  2. In bacteria (most) mRNAs are co-linear with their corresponding genes Promoter terminator gene AACTGACGA +1 AACUGACGA bacteria: mRNA AACGA

  3. Noncoding Coding sequence Coding sequence Non-coding Non-coding Non-coding Non-coding Non-coding Non-coding Continuous stretch of coding sequence Continuous stretch of coding sequence AAAAA Transport to the cytoplasm Events involved in RNA processing Pre-mRNA Intron Exon1 Exon2

  4. Why does transcript splicing occur? Proteins can be modular -Different regions can have distinct functions and the modules can correspond to exons

  5. Interrupted structure allows genes to be modular secretion enzyme binding module cell anchor

  6. Interrupted structure allows genes to be modular Pre-mRNA: secretion enzyme binding module cell anchor AAAA secretion secretion enzyme enzyme binding module binding module cell anchor cell anchor Processed-mRNA

  7. Alternative splicing or:One mRNAs exon is another one’s intron! Pre-mRNA: secretion secretion enzyme enzyme binding module binding module secretion enzyme binding module cell anchor one alternative form AAAA Processed-mRNA

  8. Alternative splicing or:One mRNAs exon is another one’s intron! Pre-mRNA: enzyme binding module secretion enzyme binding module cell anchor another alternative form AAAA enzyme binding module Processed-mRNA

  9. mRNA promoter promoter How do RNA polymerases know where to begin transcription and which way to go? promoter mRNA gene gene gene mRNA First worked out in bacteria by: -comparing sequences near the start sites of transcription of many genes -by studying where RNA polymerase likes to bind to DNA

  10. How do RNA polymerases know where to begin transcription and which way to go? Comparing sequences at the promoter region of many bacterial genes provides clues: direction of transcription transcription start site only coding (sense) strand is shown; all sequences 5’-3’ -35 region -10 region +1 consensus sequence: TTGACAT…15-17bp…TATAAT

  11. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: RNA polymerase direction of transcription TTGACAT TATAAT -35 region -10 region +1 Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?

  12. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: RNA polymerase direction of transcription TTGACAT TATAAT -35 region -10 region +1 Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?

  13. RNA polymerase binds to the consensus sequences in bacterial promoters direction of transcription RNA polymerase RNA polymerase TTGACAT TATAAT -35 region -10 region +1 Would you expect RNA polymerase to bind this sequence and initiate transcription? TACAGTT TAATAT direction of transcription

  14. mRNA How do RNA polymerases know where to begin transcription and which way to go? In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase: mRNA gene gene gene mRNA TTGACAT TATAAT -10 region -35 region -10 region -35 region TAATAT TACAGTT

  15. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins transcription factors (TF’s): RNA polymerase: +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription RNA polymerase does not efficiently bind to DNA and activate transcription on its own +1

  16. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins transcription factors (TF’s): RNA polymerase: +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription Some TF’s can also inhibit transcription +1

  17. Switches and Regulators - A Metaphor • Switches control transcription (which take the form of DNA sequence) - Called regulatory elements (RE’s) or enhancers - Adjoin the promoter region, but can be quite distant • Regulators, which take the form of proteins that bind the DNA, operate the switches - Called transcription factors (TF’s) • When and how much RNA is made often is the product of multiple elements and regulators

  18. Control of gene expression • Each cell contains the same genetic blueprint • Cell types differ in their protein content • Some genes are used in almost all cells (housekeeping genes) • Other genes are used selectively in different cell types or in response to different conditions.

  19. An imaginary regulatory region RE6 RE5 RE1 RE4 RE2 RE3 Promoter

  20. Expressing a regulatory gene in the wrong place can have disastrous consequences!!! Example: Antennapedia gene in fruit flies Antennapediagene is normally only transcribed in the thorax; legs are made. A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae!

  21. Lactose tolerance: A human example of a promoter mutation

  22. Lactase levels in humans Lactase levels 2 10 Age in years

  23. World wide distribution of lactose intolerance

  24. The cellular life cycle Mitosis: dividing the content of a cell fertilized egg; a single cell!

  25. Photo: David McDonald, Laboratory of Pathology of Seattle Chromosomes - a reminder How many do humans have? • 22 pairs of autosomes • 2 sex chromosomes • Each parent contributes one chromosome to each pair • Chromosomes of the same pair are called homologs • Others are called non-homologous

  26. Homologous and non-homologous chromosomes The zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome 1p 1m 2p 2m 3p 3m 21m 21p 22p 22m Xm Xp or Y

  27. The DNA of human chromosomes # base pairs # genes # base pairs # genes

  28. The cellular life cycle Elements of mitosis: cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat

  29. Chromosome replication – a reminder • Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once. • The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)

  30. Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) held together at the centromere sister chromatids; double-stranded DNA copies of the SAME homolog

  31. Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes • Copied chromosomes (sister chromatids) stay joined together at the centromere. • Proteins pull the two sister chromatids to opposite poles • Each daughter cell gets one copy of each homolog.

  32. Mitosis -- homologous chromosomes 1m 1p joined at centromere 2 copies 1p 2 copies 1m 2 copies 1m 2 copies 1p 1m 1m 1p 1p 1m 1m 1p 1p exact copies

  33. Mitosis – following the fate of CFTR CFTR- CFTR+ 2 copies CFTR+ 2 copies CFTR- 2 copies CFTR+ 2 copies CFTR- CFTR+ CFTR+ A CFTR heterozygote (CFTR+/CFTR-) CFTR- CFTR- CFTR+ CFTR+ CFTR- CFTR-

  34. CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes Paternal chromosome Maternal chromosome Mitosis -- 2 copies of each chromosome at the start

  35. CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes DNA strands separate followed by new strand synthesis

  36. CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes • Mitosis -- after replication 4 copies • Homologs unpaired sister chromatidsjoined by centromere

  37. CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes Each daughter has a copy of each homolog

  38. Mitosis and the cell cycle

  39. Mitosis vs. Meiosis - The goal of mitosis is to make more “somatic” cells: each daughter cell should have the same chromosome set as the parental cell - The goal of meiosis is to make sperm and eggs: each daughter cell should have half the number of chromosome sets as the parental cell

  40. Meiosis: the formation of gametes • The challenge: • ensuring that homologues are partitioned to separate gametes • The solution: • Hold homologous chromosomes together by crossing over • target homologues to oppositepoles of the cell… • then separate the homologues

More Related