MOLECULAR BASİS OF CELL AGİNG

1. MOLECULAR BASİS OF CELL AGİNG Prof. Dr. Turgut ULUTİN

2. The main factors acting in aging process and the functional relationship between them

3. The aging of higher organisms is multi-factorial process. It is influenced and modified by various genetic, biochemical, regulation and other systems working at once in close contact. Each system can make direct impact on aging process or act indirectly (e.g. through other pathway). That is why interaction between mentioned systems is important too. Here we have tried to overview the influence of each factor to the aging process and to discuss how all mentioned aging-factors could act as the whole complex.

4. Mitochondriae are the main unit of chemical power supply in the cell. During the synthesis of macroergical bio-molecules free radicals are being produced as the by-product. Free radicals when released in large quantities cause intercellular oxidative stress (e.g. oxidative damage of DNA, proteins and other bio-molecules). Oxidative stress is the main reason of accelerated senescence. Free radicals can result tissue degeneration by damaging mitochondria genome and cause early apoptosis (programmed cell death) through the damage of nuclear genome. Endogenous oxidative damage and repair systems play a big role in spontaneous mutagenesis. Mutated genes usually encode nonfunctional products, which disturb biochemical or/and signaling pathways leading to more or less expressed pathological state. Free radicals attack proteins and modify them. It usually disturbs protein function and can accelerate the aging process.

5. Cell cycle is regulated by different specific proteins. At this moment we know lots of different proteins which regulate cell cycle, phase change (cancer supressors, cyclins, and MAP kinases). When these proteins are damaged by mutations cell cycle regulation can be disturbed. Cells could die or become not controlled depending on the nature of mutation- this could lead to cancer. Cell cycle regulation disorders leads to accelerated aging and/or cell malignancy.

6. We know genes concerned with pathological aging. When they are damaged organism ages much faster. These genes are named gerontogenes - aging genes. Genetic polymorphisms (determining individual's longevity) are found. The existence of longevity gene is still very real. Some age linked diseases are known in medical practice (Werner's, Bloom's, Cocaine's syndromes, progery and other). Patents had damaged various gerontogenes. It was observed that these genes encoded replication, transcription and repair machinery components of the cell.

7. Telomeres are the terminal parts of eukaryotic chromosomes. The influence to aging of telomeres is highly discussed. They are called "molecular clock" of the cell. Cell division times are correlated with telomere length. After each cell division telomeres get shorter. When telomere shortens to the critical stage, the intensity of cell division significantly decreases, and then cell differentiates and ages. Telomeres are persistent in the not aging cells: cancer and germ line.

8. The influence of transcription, translation and posttranslational modification systems to the cell is not static but highly regulated. For example, when synthesized protein is modified incorrectly (wrong phosphorylation) its function alters. If protein function is important, appropriate intracellular processes or regulation could be disturbed. Such errors lower vitality of organism and accelerate aging.

9. Intracellular processes are accordant and rigorous; it means cell is highly organized and integrated system. Information (signal transduction) and the regulation of bioprocess are the main players in the development and the maintenance of this system and aging. When mutations or modification disturb proteins/genes of signal systems, signal transduction and other bioprocesses proceed abnormally. We should not forget that organism is integrated system and all factors mentioned above act in-between with others. Mitochondrial metabolism process stimulates oxidative damage, but each cell has repair systems defeating it (reparative systems, apoptosis, etc.).

10. Aging is a natural process, living organisms are highly adapted to the laws of nature, and senescent cells are being changed with juvenile. The existence of not differentiated stem cells in every living organism has a deep meaning; they act as a depot in the regeneration of damaged cells. • In the higher organisms, aging and renovation process is strictly regulated, anyway the source of aging and renovation signal are of material nature (biomolecules), which, changes during the life cycle. Because of these changes (modifications and mutations) organism necessarily lose its battle with aging.

11. CHROMOSOME TELOMERE 3’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 5’ AATCCCAATCCC

12. Telomere • senescent cells have shorter telomeres • length differs between species • in humans 8-14kb long • telomere replication occurs late in the cell cycle

13. Functions • Provide protection from enzymatic degradation and maintain chromosome stability • Organisation of the cellular nucleus by serving as attaching points to the nuclear matrix • Allows end of linear DNA to be replicated completely

14. Replicative senescence • Telomeres shortens progressively with each • cell division • 100 base pair lost with each cell division • Growth arrest S C-FOS, ID-1,ID-2,E2F1 E2F5 P21,p16 G1 G2 Go M

15. Aging * extremelycomplex process *senescence associated gene expression *oxidative damage, replicative senescence *cell senescence can be reversed • incidence increases with age • replicative senescence tumor suppressive mechanism • marker of malignancy Cancer

16. What are telomeres? • Telomeres are… • Repetitive DNA sequences at the ends of all human chromosomes • They contain thousands of repeats of the six-nucleotide sequence, TTAGGG • In humans there are 46 chromosomes and thus 92 telomeres (one at each end) • senescent cells have shorter telomeres • length differs between species • in humans 8-14kb long • telomere replication occurs late in the cell cycle

17. Telomere function... • Telomeres are also thought to be the "clock" that regulates how many times an individual cell can divide. Telomeric sequences shorten each time the DNA replicates.

18. How are telomeres linked to aging? • Once the telomere shrinks to a certain level, the cell can no longer divide. Its metabolism slows down, it ages, and dies.

19. How Does Telomerase Work? • Telomerase works by adding back telomeric DNA to the ends of chromosomes, thus compensating for the loss of telomeres that normally occurs as cells divide. • Most normal cells do not have this enzyme and thus they lose telomeres with each division.

21. Telomeres & Aging • Healthy human cells are mortal because they can divide only a finite number of times, growing older each time they divide. Thus cells in an elderly person are much older than cells in an infant.

22. Think of it like this… • For the cell, having a long telomere can be compared to having a full tank of gas in your automobile; having a short telomere is like running on empty. Each time a cell divides, its telomeres become a little shorter until the cells simply can no longer divide (e.g., it runs out of fuel).

23. CELL DEATH (APOPTOSİS) Prof. Dr. Turgut ULUTİN

26. More than one way to die: Necrosis and Apoptosis cytoplasmic, nuclear condensation chromatin margination swelling of the cytoplasm Swelling of the nucleus osmotic shock rapid membrane permeablization membrane blebbing Apoptosis Necrosis cell implosion and formation of apoptotic bodies release of intracellular content recognition and engulfment of apoptotic bodies by phagocytic cells

27. More than one way to die: Necrosis and Apoptosis cytoplasmic, nuclear condensation chromatin margination rapid membrane permeablization swelling of the cytoplasm Swelling of the nucleus membrane blebbing Apoptosis Necrosis cell implosion and formation of apoptotic bodies osmotic shock release of intracellular content recognition and engulfment by phagocytic cells

29. Phagocyte ScavengerReceptors ? Oxidized LDL-like Site PS ApoptoticCell Phosphatidyl-serineReceptors C1qBindingSite C1q Bridge RAC-1 DOCK 180 C1q Receptor ELMO CRKII CytoskeletalReorganization forEngulfment Apoptosis and Phagocytosis • Phagocytes recognize “eat-me” or cell corpse signals on the apoptotic cell surface. These signal the phagocyte to activate cellular engulfment machinery. • Phosphatidylserine exposure on the target cell surface and the phosphatidylserine receptor on the phagocyte are essential for phagocytosis. • Defining other receptors, bridge molecules, “eat-me” signals and signaling molecules involved in initiating the cytosolic changes needed for engulfment are very active areas of research. The articles listed below review current knowledge and are the sources for this diagram. Savill, J. and Fadok, V. 2000. Nature. 407:784. Canradt, B. 2002. Nature Cell Biol.4:E139. Apoptosis Oxygen Society Education Program Tome & Briehl 5

30. 1. Phagocyte ApoptoticCell With "eat me"signals 2. Phagocyte HealthyCell Phagocyte inducesapoptotic machineryin healthy cell 3. Engulfment Phagocyte Apoptotic cell inducesphagocytic machineryin phagocyte ApoptoticCell With "eat me"signals 4. PhagocytePrecursor Apoptotic cell inducesmaturation of precursorinto phagocyte ApoptoticCell With "eat me"signals Apoptosis and Phagocytosis • The first pathway shows the engulfment of an apoptotic cell exposing “eat-me” signals. • Data from mammalian systems and genetic studies from Caenorhabditis elegans have shown that phagocytes and target cells have several types of interactions. • Conradt has proposed several models (2-4) to indicate the more complex phagocyte-target interactions. Conradt, B. 2002. Nature Cell Biol. 4:E139. Greene, D.R. and Beere, H.M. 2001. Nature. 412:133. Apoptosis Oxygen Society Education Program Tome & Briehl 6

33. THE APOPTOTIC PATHWAY Triggers Modulators Effectors Substrates DEATH . Many cellular proteins . DNA . FADD . TRADD . FLIP . Bcl-2 family . Cytochrome c . p53 . Mdm2 . Caspases . Growth factor Deprivation . Hypoxia . Loss of adhesion . Death receptors . Radiation . Chemotherapy

34. CASPASES Caspase-1 (ICE) Caspase-2 (ICH-1, Nedd-2) Caspase-3 (CPP32, Apopain, Yama) Caspase-4 (ICH-2, TX, ICEreıı) Caspase-5 (ICErelııı, TY) Caspase-6 (Mch2) Caspase-7 (ICE-LAP3, Mch3, CMH-1) Caspase-8 (FLICE, Mch5, MACH) Caspace-9 (Mch6, ICE-LAP6) Caspase-10 (Mch4)

35. SUBSTRATES for CASPASES ... PARP ... DNA-PK ... pRb ... Lamins ... NuMA ... Fodrin ... -Aktin ... Mdm2 ... Cyclin A2 ... Presenilin ... Others

36. Why should a cell commit suicide? There are two different reasons.

37. 1. Programmed cell death is as needed for proper development as mitosis is. Examples: - The resorption of the tadpole tail at the time of its metamorphosis into a frog occurs by apoptosis. - The sloughing off of the inner lining of the uterus (the endometrium) at the start of menstruation occurs by apoptosis. - The formation of the proper connections (synapses) between neurons in the brain requires that surplus cells be eliminated by apoptosis

38. 2. Programmed cell death is needed to destroy cells that represent a threat to the integrity of the organism. Examples: - Cells infected with viruses One of the methods by which cytotoxic T lymphocytes (CTLs) kill virus-infected cells is by inducing apoptosis. (And some viruses mount countermeasures to thwart it.) - Cells with DNA damage Damage to its genome can cause a cell * to disrupt proper embryonic development leading to birth defects * to become cancerous. Cells respond to DNA damage by increasing their production of p53. p53 is a potent inducer of apoptosis. Is it any wonder that mutations in the p53 gene, producing a defective protein, are so often found in cancer cells (that represent a lethal threat to the organism if permitted to live)?

39. What makes a cell decide to commit suicide? The balance between: - the withdrawal of positive signals; that is, signals needed for continued survival - the receipt of negative signals

40. Withdrawal of positive signals The continued survival of most cells requires that they receive continuous stimulation from other cells and, for many, continued adhesion to the surface on which they are growing. Some examples of positive signals: - growth factors for neurons - Interleukin-2 (IL-2), an essential factor for the mitosis of lymphocytes

41. Receipt of negative signals - increased levels of oxidants within the cell - damage to DNA by these oxidants or other agents like * ultraviolet light * x-rays * chemotherapeutic drugs - molecules that bind to specific receptors on the cell surface and signal the cell to begin the apoptosis program. These death activators include: * Tumor necrosis factor - alpha (TNF-a ) that binds to the TNF receptor; * Lymphotoxin (also known as TNF-b) that also binds to the TNF receptor; * Fas ligand (FasL), a molecule that binds to a cell-surface receptor named Fas (also called CD95)

42. Apoptosis • For every cell, there is a time to live and a time to die. • There are two ways in which cells die: • they are killed by injurious agents • they are induced to commit suicide

43. Death by injury • Cells that are damaged by injury, such as by • mechanical damage • exposure to toxic chemicals • undergo a characteristic series of changes: • they (and their organelles like mitochondria) swell • the cell contents leak out, leading to • inflammation of surrounding tissues

44. Death by suicide Cells that are induced to commit suicide: - shrink - have their mitochondria break down with the release of cytochrome c - develop bubble-like blebs on their surface - have the chromatin (DNA and protein) in their nucleus degraded - break into small, membrane-wrapped, fragments - The phospholipid phosphatidylserine, which is normally hidden within the plasma membrane is exposed on the surface. - This is bound by receptors on phagocytic cells like macrophages and dendritic cells which then engulf the cell fragments. - The phagocytic cells secrete cytokines that inhibit inflammation. The pattern of events in death by suicide is so orderly that the process is often called programmed cell death or PCD. The cellular machinery of programmed cell death turns out to be as intrinsic to the cell as, say, mitosis. Programmed cell death is also called apoptosis

45. The Mechanisms of Apoptosis There are 2 different mechanisms by which a cell commits suicide by apoptosis. - one generated by signals arising within the cell - the other triggered by death activators binding to receptors at the cell surface. * TNF-a * Lymphotoxin * Fas ligand (FasL)

47. Apoptosis triggered by internal signals - In a healthy cell, the outer membranes of its mitochondria express the protein Bcl-2 on their surface. - Bcl-2 is bound to a molecule of the protein Apaf-1. - Internal damage in the cell causes Bcl-2 * to release Apaf-1 * to no longer keep cytochrome c from leaking out of the mitochondria - The released cytochrome c and Apaf-1 bind to molecules of caspase 9.

48. Mitochondrial Pathway Death Receptor Pathway ceramide others oxidants FasL Fas/Apo1 /CD95 DNA damage D D Bcl-2 D D D FADD DISC Procaspase 8 Apaf -1 BID Procaspase 9 Cytochrome c Caspase 8 Procaspase 3 Apaf -1 dATP dATP Caspase 3 Cellular targets apoptosome Caspase 9 Major Apoptotic Pathways in Mammalian Cells Hengartner, M.O. 2000. Nature. 407:770. Green, D. and Kroemer, G. 1998. Trends Cell Biol.8:267. Apoptosis Oxygen Society Education Program Tome & Briehl 3