Today…
Genome 351 , 11 April 2014, Lecture 4. Today…. mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division.
Today…
E N D
Presentation Transcript
Genome 351, 11 April 2014, Lecture 4 Today… • mRNA splicing • Promoter recognition • Transcriptional regulation • Mitosis: how the genetic material is partitioned during cell division Please be sure to turn in your first problem set assignment today, and also pick up the second problem set http://courses.washington.edu/gen351/
The form of mRNA Translation start Translation stop Non-coding Coding sequence that gets translated into protein Non-coding 5’ 3’ An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence The non-coding portion is often referred to as the ‘untranslated region’ or UTR.
In bacteria (most) mRNAs are co-linear with their corresponding genes introns Promoter Transcription terminator gene …AACTCACGA… +1 …AACUCACGA… bacteria: mRNA Translation (pre-mRNA) exons …AACGA… (processed mRNA) eukaryotes: introns are removed during transcription in the nucleus
Noncoding Coding sequence Coding sequence Intron removed Non-coding Non-coding Non-coding Splice out the intron Non-coding Non-coding Non-coding Continuous stretch of coding sequence Add a string of A’s to the end Continuous stretch of coding sequence AAAAA Transport to the cytoplasm Events involved in RNA processing Pre-mRNA Intron Exon1 Exon2 Processed-mRNA
Why does transcript splicing occur? Proteins can be modular -Different regions can have distinct functions and the modules can correspond to exons
Interrupted structure allows genes to be modular untranslated sequences introns secretion enzyme binding module cell anchor exons introns can also lie in untranslated sequences
Interrupted structure allows genes to be modular Pre-mRNA: untranslated sequences introns secretion enzyme binding module cell anchor exons introns can also lie in untranslated sequences
Interrupted structure allows genes to be modular Pre-mRNA: All three introns removed secretion enzyme binding module cell anchor polyA tail added AAAA secretion secretion enzyme enzyme binding module binding module cell anchor cell anchor Processed-mRNA This form stays anchored to the plasma membrane
Alternative splicing or:One mRNAs exon is another one’s intron! Pre-mRNA: Three introns & an exon removed secretion secretion enzyme enzyme binding module binding module secretion enzyme binding module cell anchor one alternative form AAAA Processed-mRNA This form is secreted
Alternative splicing or:One mRNAs exon is another one’s intron! Pre-mRNA: Three introns & two exons removed enzyme binding module secretion enzyme binding module cell anchor another alternative form Many additional possibilities with alternative splicing AAAA enzyme binding module Processed-mRNA This form is retained in the cytoplasm
ApoE gene 112 158 Promoter exons worldwide frequency Allele 112 158 ApoE2 cys cys 8% ApoE3 cys arg 78% 10-30-fold increased risk of AD ApoE4 arg arg 14%
mRNA promoter promoter How do RNA polymerases know where to begin transcription and which way to go? promoter mRNA gene gene gene mRNA First worked out in bacteria by: -comparing sequences near the start sites of transcription of many genes -by studying where RNA polymerase likes to bind to DNA
How do RNA polymerases know where to begin transcription and which way to go? Comparing sequences at the promoter region of many bacterial genes provides clues: TTGACAT…15-17bp…TATAAT -35 -10 direction of transcription transcription start site only coding (sense) strand is shown; all sequences 5’-3’ Promoter Strength (# of mRNAs made/time) ACAGTGA…15-17bp…CTGTCA -35 -10 Relatedness of promoter to consensus -35 region -10 region +1 are these important? consensus sequence: TTGACAT…15-17bp…TATAAT
RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: RNA polymerase direction of transcription TTGACAT TATAAT -35 region -10 region +1 -35 binding part of RNA polymerase -10 binding part of RNA polymerase RNA polymerase actually makes contacts with both strands of the DNA double helix; my figure is an oversimplification Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?
RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: RNA polymerase direction of transcription TTGACAT TATAAT -35 region -10 region +1 -10 binding part of RNA polymerase -35 binding part of RNA polymerase Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?
RNA polymerase binds to the consensus sequences in bacterial promoters direction of transcription RNA polymerase RNA polymerase = 5’ TTGACAT 3’ 3’ TTGACAT 5’ TTGACAT TATAAT 3’ 5’ -35 region -10 region +1 These are chemically distinct molecules with different 3-D shapes!! Would you expect RNA polymerase to bind this sequence and initiate transcription? TACAGTT TAATAT 3’ 5’ direction of transcription
mRNA How do RNA polymerases know where to begin transcription and which way to go? In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase: mRNA gene gene gene mRNA TTGACAT TATAAT similar principles- but a different mechanism-orients RNA polymerase in eukaryotes -10 region -35 region -10 region -35 region TAATAT TACAGTT
In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase: +1 RNA polymerase does not efficiently bind to DNA and activate transcription on its own
In eukaryotes, RNA polymerase is regulated by DNA-binding proteins transcription factors (TF’s): RNA polymerase: +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription RNA polymerase does not efficiently bind to DNA and activate transcription on its own +1
In eukaryotes, RNA polymerase is regulated by DNA-binding proteins transcription factors (TF’s): RNA polymerase: +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription RNA polymerase does not efficiently bind to DNA and activate transcription on its own Some TF’s can also inhibit transcription +1
Switches and Regulators - A Metaphor • Switches control transcription (which take the form of DNA sequence) - Called regulatory elements (RE’s) or enhancers - Adjoin the promoter region, but can be quite distant • Regulators, which take the form of proteins that bind the DNA, operate the switches - Called transcription factors (TF’s) • When and how much RNA is made often is the product of multiple elements and regulators
Control of gene expression • Each cell contains the same genetic blueprint • Cell types differ in their protein content • Some genes are used in almost all cells (housekeeping genes) • Other genes are used selectively in different cell types or in response to different conditions.
Turns on in brain Controls timing of transcription Inhibits transcription Increases transcription An imaginary regulatory region RE6 RE5 RE1 RE4 RE2 RE3 Promoter
Expressing a regulatory gene in the wrong place can have disastrous consequences!!! Example: Antennapedia gene in fruit flies Antennapediagene is normally only transcribed in the thorax; legs are made. A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae!
lactose tolerant lactose intolerant Lactase levels in humans Lactase levels 2 10 Age in years
World wide distribution of lactose intolerance Convergent evolution: independent acquisition of the same biological trait in distinct populations
The cellular life cycle Mitosis: dividing the content of a cell fertilized egg; a single cell! The formation of sperm and eggs-more later on this subject How is the genetic material equally divided during mitosis?
Photo: David McDonald, Laboratory of Pathology of Seattle Chromosomes - a reminder How many do humans have? • 22 pairs of autosomes • 2 sex chromosomes • Each parent contributes one chromosome to each pair • Chromosomes of the same pair are called homologs • Others are called non-homologous
Homologous and non-homologous chromosomes The zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome homologous 1p 1m 2p 2m homologous 3p 3m 21m 21p 22p 22m non-homologous Xm Xp or Y
The DNA of human chromosomes # base pairs # genes # base pairs # genes
The cellular life cycle Elements of mitosis: cell growth; chromosome duplication cell growth; chromosome duplication What are decondensed chromosomes? How are chromosomes duplicated? chromosomes decondensed
Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) a condensed chromosome
Chromosome replication – a reminder • Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once. • The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)
Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) What is a centromere? held together at the centromere sister chromatids; double-stranded DNA copies of the SAME homolog a condensed chromosome
The cellular life cycle Elements of mitosis: cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed only showing a single duplicated homolog – 45 others not shown chromosome segregation chromosomes condensed repeat
The cellular life cycle Elements of mitosis: cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed only showing a single duplicated homolog – 45 others not shown chromosome segregation chromosomes condensed repeat
The cellular life cycle Elements of mitosis: cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat
Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes • Copied chromosomes (sister chromatids) stay joined together at the centromere. • Proteins pull the two sister chromatids to opposite poles • Each daughter cell gets one copy of each homolog. Understand what’s happening to the chromosomes!
Mitosis -- homologous chromosomes 1m 1p joined at centromere 2 copies 1p 2 copies 1m 2 copies 1m 2 copies 1p 1m 1m 1p 1p 1m 1m 1p 1p exact copies
Mitosis – following the fate of CFTR 1m 1p joined at centromere 2 copies 1p 2 copies 1m 2 copies 1m 2 copies 1p 1m 1m 1p 1p 1m 1m 1p 1p exact copies
Mitosis – following the fate of CFTR CFTR- CFTR+ 2 copies CFTR+ 2 copies CFTR- 2 copies CFTR+ 2 copies CFTR- CFTR+ CFTR+ A CFTR heterozygote (CFTR+/CFTR-) CFTR- CFTR- CFTR+ CFTR+ CFTR- CFTR- exact copies
CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes Paternal chromosome Maternal chromosome Mitosis -- 2 copies of each chromosome at the start
CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes DNA strands separate followed by new strand synthesis
CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes • Mitosis -- after replication 4 copies • Homologsunpaired; sister chromatidsjoined by centromere
CTCCTCAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGTGGAG GTGCACCTGACTCCTGAGGAG GTGCACCTGACTCCTGAGGAG A closer look at the chromosomes Each daughter has a copy of each homolog
Mitosis and the cell cycle DNA synthesis Chromosome condensation One copy of each chromosome to each daughter Nuclear membrane breakdown Chromosome alignment
number of copies of any given chromosome/cell (n): Mitosis vs. Meiosis 2 Mitosis: dividing somatic cells - The goal of mitosis is to make more “somatic” cells: each daughter cell should have the same chromosome set as the parental cell - The goal of meiosis is to make sperm and eggs: each daughter cell should have half the number of chromosome sets as the parental cell 2n = diploid 2n 2n 1n 1n = haploid 1n Meiosis: the formation of gametes number of copies of any given chromosome/sperm or egg: 1
Why reduce the number of chromosome sets during meiosis? 2n 2n 2n 2n 2n 2n 1n 1n zygote: 2n 4n!!