natane
Uploaded by
79 SLIDES
963 VUES
790LIKES

제 5 장 동물 분자육종을 위한 DNA 표지인자의 이용

DESCRIPTION

제 5 장 동물 분자육종을 위한 DNA 표지인자의 이용. 동물육종 방법의 변화. 전통적인 통계적 보정 방법에 의한 동물육종. DNA 상의 특성 및 유전자 조작에 의한 동물육종. ( 교재 133 참조 ). Molecular Methods for Identification of Genotypes Basic Concept. DNA 의 다형현상.

1 / 79

Télécharger la présentation

제 5 장 동물 분자육종을 위한 DNA 표지인자의 이용

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 제5장 동물 분자육종을 위한 DNA 표지인자의 이용 동물육종 방법의 변화 전통적인 통계적 보정 방법에 의한 동물육종 DNA상의 특성 및 유전자 조작에 의한 동물육종 (교재 133 참조)

  2. Molecular Methods for Identification of Genotypes Basic Concept DNA의 다형현상 • The number of nucleic acid or amino acid differences between two organisms is proportional to the time since they diverged from a common ancestor. 1 2 3 1 AAGGCTA 2 AAGGGTA 3 AAGGGTG Example Rate of Evolution = 1bp per 100 years MOLECULAR DIFFERENCES 100years 200 years TIME

  3. MARKERS IN BIOLOGY Phenotypic markers = Naked eye markers Flower colors, shape of pods, etc.. • P = E+G

  4. Polymorphisms • Differences can be detected: • Visually – morphological traits B. Vandenberg P1 F1 P2

  5. Molecular markers • Sequencing (SNPs) • Microsatellites (SSRs) • Multi-locus fingerprints • AFLP(Amplified Fragment Length Polymorphism) Resolutionpower • RAPD (medium)(random amplified polymorphic DNA) • RFLP, Restriction Fragment Length Polymorphisms (high) • SSCP, Single Strand Conformation Polymorphisms (very low)

  6. DNA의 다형현상 (DNA Polymorphism=differences) 개체간의 DNA의 차이를 DNA polymorphism이라 함 DNA염기서열을 분석하여 개체간 특성 파악 제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) 임의증폭다형(Random Amplified Polymorphic DNAs, RAPD) 초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP)

  7. 왜 DNA의 다형현상은 일어나는가? • Molecular differences can be caused by: • INSERTIONS • Johnny is a boy • Johnny is a bad boy • DELETIONS • The cow jumped over the moon • The cow over the moon • MUTATIONS • Bean • Been • These may cause phenotypic differences

  8. DNA의 다형현상 T-T-G-A-C-T-A-A-C-C-A-G-A-T-CI I I I I I I I I I I I I I IA-A-C-T-G-A-T-T-G-G-T-C-T-A-G E. coli isolate A E. coli isolate B SNP(single nucleotide polymorphism) T-T-G-A-C-T-A-C-C-C-A-G-A-T-CI I I I I I I I I I I I I I IA-A-C-T-G-A-T-G-G-G-T-C-T-A-G

  9. 제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) • Restriction Fragment Length Polymorphism • 1980 Botstein et al. • polymorphisms due to changes in restriction sites or in DNA between sites

  10. RFLP • Restriction fragment length polymorphism • Co-dominant • Requires: • single copy DNA probe • Restriction enzyme • Southern blotting • DNA polymorphism

  11. Gel configuration P 1 P 2 O 1 O 2 Gel configuration P 1 P 2 O 2 O 1 Co-dominant marker Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Dominant marker Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ????

  12. Inheritance of RFLPs 자손에게 유전

  13. RFLP linkage analysis • RFLPs provide useful markers for all of the human chromosomes • disease genes can be mapped by searching for linkage between an • RFLP and the disease phenotype RFLP probe disease gene A normal gene a • the A/a polymorphism is linked to the disease-causing gene AA Aa aa AA homozygous for ‘A’ Aa heterozygous aa homozygous for ‘a’ • In a dominant disease, AA and Aa would • be affected • In a recessive disease, AA would be • affected and Aa would be a carrier

  14. RFLP probe normal gene A X recombination? disease gene a • the test subject is determined to have the • same genotype as its sibling and therefore • can be predicted to get the disease • the prediction must be qualified, • however, because of the • possibility of recombination • between the polymorphic • marker and the disease gene • the frequency of recombination • and therefore the reliability • of the marker is dependent • on the distance between the • two sites affected child test subject mother father Aa Aa aa aa

  15. Genotype Determination using RFLP's and a Gene Probe A DNA probe that hybridizes to the 5' end of the human beta globin gene (shown in blue on the diagram below) was used to identify RFLP pieces from members of a family in which sickle-cell hemoglobin (HbS) was segregating. The normal HB allele (HbA) is cut at three places by a particular restriction enzyme (positions shown with red arrows). The HbS mutation destroys the internal restriction site so the HbS gene is cut in only two places. Thus, the probe hybridizes to a 1.15 kb DNA fragment from HbA DNA and hybridizes to a 1.35 kb fragment from HbS DNA.

  16. P1 P2 Restriction sites e.g. EcoR1 recognizes GAATTC and cuts between G and A

  17. DNA taken from three individual animals, cut with a restriction enzyme and separated by gel electrophoresis... 23 KB 9.4 KB 6.7 KB 4.3 KB 2.3 KB 2.0 KB 0.6 KB

  18. homozygote heterozygotes Autoradiograph of Southern blot produced from previous genomic DNA restiction digest, probed with a muscle actin gene probe... DNA polymorphism: 3 different “genotypes”

  19. RFLP • DNA cut with restriction enzyme, separated by size on an agarose gel, hybridized to a filter • To see bands, probe with a labeled fragment of DNA • probes = genomic clones, cDNAs, ESTs • Labeled with 32P or fluorescence

  20. RFLP techniques

  21. P1 P2 Southern Hybridization F2 P1 P2 F1 Transfer to a membrane Probe with DNA fragment

  22. P1 P2 F2 P1 P2 F1

  23. 자식들 부모 P1 P2

  24. 임의증폭다형(Random Amplified Polymorphic DNAs, RAPD) RAPD • Random Amplified Polymorphic DNA • Williams et al. 1990 • Amplify fragments of DNA using a SINGLE, RANDOM oligonucleotide primer (usually 10mer) • Run out product on agarose gel, stain with ethidium bromide and visualize using UV • Polymorphisms due to differences in and between primer annealing sites

  25. Random Amplified Polymorphic DNA (RAPD) RAPD • Amplifies anonymous stretches of DNA using arbitrary primers • Fast and easy method for detecting polymorphisms • Domimant markers • Reproducibility problems

  26. Random Amplified Polymorphic DNA (RAPD) PCR products on agarose gel C C/L C C/L C L L L Strain 2 Landsberg Strain 1 Columbia parental DNA mapping population 순수 혹은 잡종분별 Primer 5’ GCCGTAGCAAGT Strain 1 Columbia 5’ 3’ CCGTACGTAGCAAGT-.....NNNNNNNNN___...ACTTGCGGCGTA GCCGTAGCAAGT 5’ Primer 5’ GCCGTAGCAAGT 5’ Strain 2 Landsberg 5’ CCGTACGTAGCAAGG-.....NNNNNNNNN___...ACTTGCGGCGTA

  27. Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ Sequences of 10-mer RAPD primers RAPD gel configuration RAPD Polymorphisms among landraces of sorghum M

  28. 초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP) Microsatellites (SSR) • polymorphisms in the number of di-, tri-, tetra- or penta-nucleotide repeats • scattered throughout the genome • Often arise due to ‘stuttering’ during DNA synthesis or uneven pairing and crossing-over • primers designed based on flanking DNA sequences • Requires large amounts of sequencing to develop - $$$

  29. R R S S S R S R S R S R Parent 1 - resistant AGTGCATGAGCGCGCGCGCGCGTCTCTATGTC Parent 2 - susceptible AGTGCATGAGCGCGCGCGCGCGCGCGTCTCTATGTC

  30. Microsatellites (SSR) • PCR products run out on agarose gels(if not too close in size) or more often, on polyacrylamide gels(if only a few bases separate the 2 genotypes • Visualized by using labeled primers (radioactive or fluorescent) or with ethidium bromide or silver staining

  31. Repeat Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA….. GGT(5) SSR repeats and primers GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG

  32. AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 SSR polymorphisms Gel configuration

  33. bp 207 169 Agriculture and Agri-Food Canada Genographer image of microsatellite sORB30 in a B. napus population sORB30 P1 P2

  34. Simple Sequence Length Polymorphism (SSLP) Reverse Primer Reverse Primer Forward Primer Forward Primer ACGT GA (GA)78 GA CCTG ACGT GA (GA)44 GA CCTG Strain 1 Columbia Strain 2 Landsberg PCR Strain 2 Landsberg Strain 1 Columbia

  35. 범인1 범인2 희생자

  36. ? ? 엄마 형제자매 엄마 형제자매

  37. Agriculture and Agri-Food Canada ABI 377-96 microsatellite mapping gel

  38. 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) (교재136-137) • Theory: the conformation of single-stranded DNA is dependent on its primary sequence • Purpose: to electrophoretically separate PCR fragments that differ by a few bases. • PCR hypervariable fragment of gene. • Denature into single-strands by heating. • Run on a polyacrylamide gel • PCR products with different sequences will run a different speeds on the gel.

  39. 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Single strand conformation polymorphism analysis (SSCP), takes advantage of the secondary structure (conformation) of single stranded DNA. A mutation in a DNA strand may change the conformation of that strand. The mutant conformation may electrophorese differently to the wild type conformation.

  40. Denature Renature rapidly Wild type Mutant 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP)

  41. Wild type Mutant 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Electrophorese ss DNA ds DNA WT M

  42. NT kid blood (Jinsoon) Recipient blood Donor cell line PCR- SSCP analysis of the second exon of the goat MHC class ll DRB gene PCR products were denaturedat 80°C for 5 min and immediately chilledon ice for 2min. The samples were run for 3.5hrs on 10% polyacrylamidegels in 1% TBE buffer at 100V and the bands were visualized by ethidium bromide under the UV light.

  43. SNPs on a DNA strand Hybridization using fluorescent dyes SNPs (Single Nucleotide Polymorphisms) • Any two unrelated individuals differ by one base pair every • 1,000or so, referred to as SNPs. • Many SNPs have no effect on cell function and therefore • can be used as molecular markers.

  44. SNP (Single Nucleotide Polymorphism) • SNPs, the most common form of genetic polymorphism causing diversities among different individuals. • SNPs are estimated to occur every 500-1000 bp (3,000,000 to 6,000,000 SNPs) • To facilitate large scale genetic association studies • Approximately 1,000,000 human SNP’s currently mapped • Useful in pharmacogenomics, advanced disease screening studies, etc…

  45. SNP Analysis • SNP Discovery:Direct sequencing and comparative analysis • Quality Values • CEQuence Investigator • SNP Scoring:Rapid identification of known SNPs by microsequencing or primer extension • CEQ or SNPstream Analysis • Primer Extension chemistry

  46. DNA polymorphism 분석에 의한 동물육종 개체에 의한 유전자형을 손쉽고 정확하게 파악하여 개체에 대한 육종가 추정 대동물에서 착상전 수정란의 성감별 유전병 등 열성형질을 제거하기 위한 종축집단 구축 육종 프로그램내의 혼선을 방지하기 위한 개체나 집단간의 혈연관계 확인 형질관련 유전자의 분리를 위한 도구로서 유전자 지도 작성시의 이용

More Related