Simple Animals, Complex Genomes
Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley Reddien Lab, Whitehead Institute for Biomedical Research 02.23.13. Outline. Introduction
Simple Animals, Complex Genomes
E N D
Presentation Transcript
Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley Reddien Lab, Whitehead Institute for Biomedical Research 02.23.13
Outline • Introduction • Insights from genomic analyses • 3. Linking genomic complexity to biological complexity
What is the genomic basis for the difference in complexity? BILATERIANS PLACOZOANS SPONGES CNIDARIANS bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade ? multicellularity
Three species were selected for genome sequencing SEA ANEMONE PLACOZOAN SPONGE
Nematostellavectensisis a sea anemone Nematostella is a great lab rat (Finnerty et al. 2004)
Trichoplaxis a placozoan (photo credits: Ana Signorovitch, Michael Eitel, Bernd Schierwater)
Amphimedonqueenslandica is a sponge Adult Larvae (photo credits: Bernie Degnan)
These animal genomes have been sequenced using a Whole Genome Shotgun strategy ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAATGTGTGATTC
These animal genomes have different sizes, but the numbers of genes/proteins are in the same ballpark Genome exon intron Genes Proteins
Before comparing their genomes, we need to know how these animals are related to each other and to us * * * * * * BILATERIANS BILATERIANS Not an ancient animal gene Ancient animal gene Lost in sponges
Orthologous protein sequences can reveal how organisms are related to each other RLKMTPIR PIDWDCMW RKLPDCMW MTLPDCMW fly fish human mouse Live birth, hair, warm blood, four chambered heart vertebrae RLKMTPIR PIDWDCMW RKLPDCMW MTLPDCMW
Placozoans represent a sister lineage to cnidarians and bilaterians Cnidaria Bilateria Animals
Whole-genome data can resolve early animal relationships BILATERIANS SPONGES PLACOZOANS CNIDARIANS bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade multicellularity
Previously, some developmental processes were thought to be conserved in the bilaterian ancestor A-P patterning Hoxcomplex Gene structure or genome organization (except for the Hox cluster) were not known to be ancient
How do the structures of genes compare between animal genomes? Genome exon intron Genes Proteins
Sea anemones, placozoans, and sponges have preserved many (>80%) ancient introns (this is not the case for flies and nematodes, which have lost a majority of ancestral metazoan introns) (in collaboration with UffeHellsten)
The positions of orthologous genes can be compared between two species
Gene order conservation decreases with evolutionary distance Synteny “same thread” genes present on the same chromosome
No chromosome scale syntenyis observed between vertebrates and flies Human Drosophila
Nematostella, Trichoplax, and Amphimedon scaffolds show conserved synteny with human chromosome segments (Nik Putnam)
There is considerable scrambling of gene order in these blocks of conserved synteny (Nik Putnam)
Early animal lineages may lack certain cell types or biological processes, but their genomes encode the proteins required for these in bilaterians
Many “important” genes are involved in processes essential for animal multicellularity Six hallmarks of animal multicellularity: Regulated cell cycle and growth Programmed cell death Cell-cell and cell-matrix adhesion Allorecognitionand innate immunity Specialization of cell types Developmental signaling
Comparing early animal genomes allows us to study the temporal origins of animal biology Six hallmarks of animal multicellularity: Regulated cell cycle and growth Programmed cell death Cell-cell and cell-matrix adhesion Developmental signaling Allorecognition and innate immunity Specialization of cell types
Some essential controls on the cell cycle evolved when animals first appeared
Early animal genomes are (in some ways) more similar to our genome than are the genomes of flies and nematodes SPONGES PLACOZOANS CNIDARIANS BILATERIANS A-P patterning Hox complex Metazoan “toolkit” Most signaling pathway and transcription factor families, intron-exon structure, genome organization
Explanations for differences in complexity SPONGES PLACOZOANS CNIDARIANS BILATERIANS microRNAs? cis-regulation? larger families? A-P patterning Hox complex Most signaling pathway and transcription factor families, intron-exon structure, genome organization
Differences in the numbers of some types of genes do correlate with complexity
Explanations for differences in complexity SPONGES PLACOZOANS CNIDARIANS BILATERIANS microRNAs? cis-regulation? larger families? A-P patterning Hoxcomplex Cell types patterned in complex ways? Most signaling pathway and transcription factor families, intron-exon structure, genome organization
Summary • Animals evolved a “toolkit” of genes very early in their evolution • Early animal genomes are complex! • (as are these animals) • Though not all questions are answered by the genomes, they are essential tools for finding the remaining answers
Acknowledgements Dan Rokhsar Nik Putnam, Oleg Simakov Jarrod Chapman, EminaBegovic Therese Mitros, UffeHellsten Heather Marlow and Mark Martindale (U. Hawaii) Kai Kamm, Michael Eitel, Bernd Schierwater (Hanover) Ana Signorovitch, Maria Moreno, Leo Buss, Stephen Dellaporta (Yale) Degnan group (U. Queensland), Kosik group (UC Santa Barbara) Peter Reddien Jessica Witchley, Kathleen Mazza Members of the Reddien Lab Ulf Jondelius, Swedish Museum of Natural History Wolfgang Sterrer, Bermuda Natural History Museum