Like Illumina, but immobilized templates are SS DNA molecules (~200 nt)

1. Last updated 10/26/11 http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and washes it away. Several billion single molecule “spots” per slide.

3. Helicos paired end sequencing 1 2 3 4 5 6 7

4. Helicos virtual terminator Inhibits DNA Pol once incorporated (so 1 base at a time) Cleavable via the S-S bond (reduce it) Fluorescent tag Free 3’ OH never blocked dU-3’P,5’P dUTP

5. Quantification of the yeast transcriptome by single-molecule sequencing Lipson et al. NATURE BIOTECHNOLOGY 27: 652, 2009 Tail 3’ end with A via terminal transferase, adding dT to terminate Make cDNA via oligo dT Add Cy5-labeled special nucleotide tri-Ps + DNA Pol. Wash. Record image. Hybridize to surface-linked oligo dTs Note: no amplifications or ligations Add next Cy5-labeled special nucleotide triPs (A) + DNA Pol. Wash. Record image. Cleave dye from incorporated nt. Wash.

6. smsDGE = digital gene expression via Helicos sequencing and counting MA = microarray data

7. QPCR = quantitative PCR, real time PCR Exponential phase Non-exponential plateau phase CT value Threshold line Bio-rad

8. QPCR (Quantitative PCR) Q-RT-PCR (Quantitative reverse transcription-PCR) Run 96 samples simultaneously

9. Some data produced: Distribution of yeast transcripts mRNA Est. copies/cell: 0.5 5 50 500 TSS position relative to ATG TSS = transcription start site t.p.m. = transcripts per million

10. Complete Genomics (DNA nanoballs) RCR = rolling circle replication AcuI: a type IIS restriction enzyme

11. Rolling circle DNA synthesis (Φ29 polymerase)

12. Complete Genomics

13. Complete Genomics\”CPAL Probes degenerate at all but one position, colored for the base at that position. 5 probe sets for positions +1 to +5 relative to anchor end Hybridize, wash, ligate, wash,image. Second anchor set extends 5 nt(degenerate reach). Repeat10 nt sequenced. Repeat with anchors on the other side of the adaptor. Repeat for the other 3 adaptors. Total 70 nts sequenced(theor. = 80)

14. Complete Genomics Est. 1 billion spots (reads) per slide Lower cost 200 human genomes sequenced Business plan: sell sequencing service, not machines

15. http://www.pacificbiosciences.com

16. ZMW = zero mode waveguide 10 zl volume seen (1 zeptoliter = 10-21 L.) Add template and special phospho nucleotides. One DNA Pol molecule per ZMW

17. Cleaved when incorporated Other technologies Phospho-linked fluorescently-labeled nucleoside triphosphates

18. Emission Excitation

20. Use a circular template to get redundant reads and so more accuracy.

21. Pacific Biosciences 50,000 ZMWs (Aug., 2011), and density may climb Long reads (e.g., full molecule analysis for splicing isoform) Direct RNA sequecning possible. DNA methylation detectable

22. DNA methylation detection by bisulfite conversion

23. Agilent SureSelect RNA Target Enrichment Capture a subgenomic region of interest for economy and speed of sequencing: E.g., the entire exome (all exons w/o introns or intergeneic regions) hundreds of cancer genes a particular genomic locus Alternative: hybridize to a custom microarray. Agilent

24. Applications of “deep” sequencing Also: definition and discovery of cis-acting regulatory motifs in DNA and RNA

25. Detection of methylated C (~all in CpG dinucleotides) cytosine ----CmpG--- > ----CpG-- > ----CmpG--- > < ---G p Cm--- DS DNA Na bisulfite Heat Na bisulfite Heat ----CmpG--- > ----UpG-- > PCR ----TpG-- > ----CpG-- > <--GpC--- <--ApC--- All NON-methylated Cs changed to T uracil

26. DEEP SEQUENCING (Next generation sequencing, High throughput sequencing, Massively parallel sequencing) applications:Human genome re-sequencing (mutations, SNPs, haplotypes, disease associations, personalized medicine)Tumor genome sequencingMicrobial flora sequencing (microbiome)Metagenomic sequencing (without cell culturing)RNA sequencing (RNAseq; gene expression levels, miRNAs, lncRNAs, splicing isoforms)Chromatin structure (ChIP-seq; histone modifications, nucleosome positioning)Epigenetic modifications (DNA CpG methylation and hydroxymethylation)Transcription kinetics (GROseq; nascent RNA, pulse labeled RNA)High throughput genetics (QUEPASA; cis-acting regulatory motif discovery)Drug discovery (bar-coded organic molecule libraries)

27. Ke et al, and Chasin, Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. 2011. 21: 1360-1374 ). Order an equal mixture of all 4 bases at these 6 positions

29. Rank 6-mer ESRseq score (~ -1 to +1) 1 AGAAGA 1.0339 2 GAAGAT 0.9918 3 GACGTC 0.9836 4 GAAGAC 0.9642 5 TCGTCG 0.9517 6 TGAAGA 0.9434 7 CAAGAA 0.9219 8 CGTCGA 0.8853 :: 4086 TAGATA -0.8609 4087 AGGTAG -0.8713 4088 CGTCGC 0.8850 4089 CTTAAA -0.8786 4090 CCTTTA -0.8812 4091 GCAAGA 0.8911 4092 TAGTTA -0.8933 4093 TCGCCG 0.9113 4094 CCAGCA -0.8942 4093 CTAGTA -0.9251 4094 TAGTAG -0.9383 4095 TAGGTA -0.9965 4096 CTTTTA -1.0610 Best exonic splicing enhancers Worst exonic splicing enhancers, = best exonic splicing silencers

30. Constitutive exons Alternativexons Pseudo exons Composite exon (from ~100,000)

31. 31 Sequence of 36 Quality code CGCACTGTGCTGGAGCTCCCGGGGTTAACTCTAGAA abU^Vaa`a\aaa]aWaTNZ`aa`Q][TE[UaP_U] TACACTGTGCTGGAGCTCCCAACGGCAACTCTAGAA a`P^Wa`[`Wa^`X_X_XWVa^NSP]_]S^X_T\X^ CGCACTGTGCTGGAGCTCCCATGGAGAACTCTAGAA aTa`^b``baaaa^aab^YaTQLOHIa`^a``TX]] TACACTGTGCTGGAGCTCCCCTCCCAAACTCTAGAA I_`aaaa`aaaaaaa_a_^[KZIGIGZ`U`\^P^^` CGCACTGTGCTGGAGCTCCCAATAGTAACTTTAGAA aY_\abb[T\abaaa`a`bZ[HXXIZa_`_LGMS[` TATACTGTGCTGGAGCTCCCGACGTAAACTCTAGAA aba]^aa_a]`aa]_]`XWSMFGGIPX[P]X`V_Y^ TACACTGTGCTGGAGCTCCCTGGTAAAACTCTAGAA a_^a^aa`aYaaa_aY`Y_^[I]VY\`]V]R\W]VV TACACTGTGCTGGAGCTCCCAATAAAAACTCTAGAA XZababa`aZaaaaaYaYXX`baa``\\TaUa\aW` Variable region Constant regions (peculiar to our expt.) 2 nt barcode (TA or CG) Experiment: 1 1 1 2 2 1+2 2 2 1 2

32. Next generarion method: Use custom oligo libraries to construct minigene libraries (40,000, up to 60 nt long): E.g., for saturation mutagenesis to identify all exonic bases contributing to splicing (or transcription or polyadenylation, …..) Use bar codes to detect sequences missing from the selected molecules E.g., Nat Biotechnol. 2009 27:1173-5. High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Patwardhan RP, Lee C, Litvin O, Young DL, Pe'er D, Shendure J. Long (200-mer) synthetic oligo library

33. OUTLINE OF NEXT LECTURE TOPICSExpression and manipulation of transgenes in the laboratory 33 • In vitro mutagenesis to isolate variants of your protein/gene with desirable properties • Single base mutations • Deletions • Overlap extension PCR • Cassette mutagenesis • To study the protein: Express your transgene • Usually in E. coli, for speed, economy • Expression in eukaryotic hosts • Drive it with a promoter/enhancer • Purify it via a protein tag • Cleave it to get the pure protein • Explore protein-protein interaction • Co-immunoprecipitation (co-IP) from extracts • 2-hybrid formation • surface plasmon resonance • FRET (Fluorescence resonance energy transfer) • Complementation readout

34. RS1 34 RS2 RS1 RS2 Site-directed mutagenesis by overlap extension PCR PCR fragment subsequent cloning in a plasmid Ligate into similarly cut vector 1 2 Cut with RE 1 and 2

35. 35 Cassette mutagenesis = random mutagenesis but in a limited region: 1) by error-prone PCR Original sequence coding for, e.g., a transcripiton enhancer region ---------------------------------------------------------------------------------------------------------------------- PCR fragment with high Taqpolymerase and Mn+2 instead of Mg+2 errors ------*--------*--*-**---------------*-----------*--*-------*------------------------*-*-*------------*------------*-- Cut in primer sites and clone upstream of a reporter protein sequence. Pick colonies Analyze phenotypes Sequence

36. 36 Cassette mutagenesis = random mutagenesis but in a limited region: 2) by “doped” synthesisTarget = e.g., an enhancer element ---------------------------------------------------------------------------------------------------------------------- Original enhancer sequence -*------------------------*-*-*------------*------------*-- ------*--------*--*-**---------------*-----------*--*------ Buy 2 doped oligos; anneal OK for up to ~80 nt. Clone upstream of a reporter. Doping = e.g., 90% G, 3.3% A, 3.3% C, 3.3% T at each position Pick colonies Analyze phenotypes Sequence

37. Got this far

38. 38 E. coli as a host • PROs:Easy, flexible, high tech, fast, cheap; but problems • CONs • Folding (can misfold) • Sorting -> can form inclusion bodies • Purification -- endotoxins • Modification -- not done (glycosylation, phosphorylation, etc. ) • Modifications: • Glycoproteins • Acylation: acetylation, myristoylation • Methylation (arg, lys) • Phosphorylation (ser, thr, tyr) • Sulfation (tyr) • Prenylation (farnesyl, geranylgeranyl on cys) • Vitamin C-Dependent Modifications (hydroxylation of proline and lysine) • Vitamin K-Dependent Modifications (gamma carboxylation of glu) • Selenoproteins (seleno-cys tRNA at UGA stop)

39. 39 Some alternative hosts • Yeasts (Saccharomyces , Pichia) • Insect cells with baculovirus vectors • Mammalian cells in culture (later) • Whole organisms (mice, goats, corn) (not discussed) • In vitro (cell-free), for analysis only(good for radiolabeled proteins)

40. 40 GAPDterm LEU2 GAPDprom Ampr oriE Yeast Expression Vector (example) Saccharomyces cerevisiae(baker’s yeast) 2 mu seq: yeast ori oriE = bacterial ori Ampr = bacterial selection LEU2, e.g. = Leu biosynthesisfor yeast selection 2 micron plasmid Complementation of an auxotrophy can be used instead of drug-resistance Your favorite gene(Yfg) Auxotrophy = state of a mutant in a biosynthetic pathway resulting in a requirement for a nutrient GAPD = the enzyme glyceraldehyde-3 phosphate dehydrogenase

41. Vector DNA t p gfY Genomic DNA Genomic DNA HIS4 mutation- Yeast - genomic integration via homologous recombination HIS4 t p Yfg FunctionalHIS4 gene DefectiveHIS4 gene

42. HIS4 Vector DNA AOX1t Yfg AOX1p 3’AOX1 Genomic DNA AOX1 gene (~ 30% of total protein) Genomic DNA Yfg 3’AOX1 AOX1p AOX1t HIS4 Double recombination Yeast (integration in Pichia pastoris) P. pastoris-tight control-methanol induced (AOX1)-large scale production (gram quantities) Alcohol oxidase gene

43. PROTEIN-PROTEIN INTERACTIONS Yeast 2-hybrid system to discover proteins that interact with each other Or to test for interaction based on a hypothesis for a specific protein. (bait) ? Y = e.g., a candidate protein being tested for possible interaction with X Or: Y = e.g., a cDNA library used to discover a protein that interacts with X ? (prey) BD = (DNA) binding domain AD = activation domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html

44. No interaction between X and Y: no reporter expression Yes, interaction between X and Y: reporter protein is expressed: Y = e.g., a cDNA library used to discover a protein that interacts with X Recover the Y sequence from reporter+ colonies by PCR to idenify protein Y

45. Fusion library Bait protein is the known target proteinfor whom partners are sought =“prey” and/or Two different assays help, as there are often many false positives. BD= DNA binding domain; TA = transactiavting domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html

46. 3-HYBRID: select for proteins domains that bind a particular RNA sequence Prey Bait Prey could be proteins from a cDNA library

47. Yeast one-hybrid: Insert a DNA sequence upstream of the selectable or reporter Transform with candidate DNA-binding proteins (e.g., cDNA library) fused to an activator domain. Each T = one copy of a DNA target sequence

48. Indirect selection using a yeast 3-hybrid system:a more efficient glycosynthase enzyme Directed Evolution of a Glycosynthase via Chemical Complementation Hening Lin,† Haiyan Tao, and Virginia W. Cornish J. AM. CHEM. SOC. 2004, 126, 15051-15059 Turning a glycosidase into a glyco-synthase Glycosidase: Glucose-Glucose (e.g., maltose) + H2O  2 Glucose

49. Indirect selection using the yeast 3-hybrid system(one of the hybrid moelcules here is a small molecule) e.g., from a mutated library of enzyme glycosynthase genes glucose Leu2 gene Leu2 gene Transform a yeast leucine auxotroph. Provide synthetic chimeric substrate molecules. Select in leucine-free medium. DHFR = dihydrofolate reductase GR = glucocorticoid receptor (trancription factor ) MTX = methotrexate (enzyme inhibitor of DHFR) DEX = dexamethasone, a glucocorticoid agonist, binds to GR AD = activation domain, DBD = DNA binding domain

50. Selection of improved cellulases via the yeast 2-hybrid system Survivors are enriched for cellulase genes that will cleave cellulose with greater efficiency (kcat / Km) Yeast cell Cellobiose (disaccharide) URA-3 (toxic) cellulase Directed Evolution of Cellulases via Chemical Complementation. P. Peralta-Yahya, B. T. Carter, H. Lin, H. Tao. V.W. Cornish. JACS 2008, 130, 17446–17452 x x x x Library of cellulase mutant genes (one per cell)