nijole
Uploaded by
28 SLIDES
678 VUES
340LIKES

Plant Hormones

DESCRIPTION

Plant Hormones. Anjali More University of Arkansas. Why do plants need hormones?. Hormones enable plants to: Respond to environmental factors and changes Direct developmental processes. Why do plants need hormones?. Parasites. Light. Temperature. Pathogens. Humidity. Insects. Stress.

1 / 28

Télécharger la présentation

Plant Hormones

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Plant Hormones Anjali More University of Arkansas

  2. Why do plants need hormones? Hormones enable plants to: • Respond to environmental factors and changes • Direct developmental processes

  3. Why do plants need hormones? Parasites Light Temperature Pathogens Humidity Insects Stress Toxins Oxygen

  4. What are hormones? • Harman - “to set in motion” • A chemical messenger from one cell (or group of cells) to another • Signal molecules produced at specific locations • Found in low concentrations • Cause altered processes in target cells at other locations • Found in multicellular organisms

  5. What are plant hormones? • Occur in small amounts • Organic compounds • Synthesized by plants • Active at low concentrations • Promote or inhibit growth and developmental responses • Often show a separation from the site of production and the site of action Plant hormones do not always have all these characteristics Plant growth regulators or plant growth substances

  6. Physiological response Plant hormones are chemical messengers Hormone synthesis Message

  7. General Plant Hormones • Auxins • Cytokinins • Abscisic acid • Ethylene • Gibberellins • Jasmonic acid • Salicylic acid Classical phytohormones

  8. Indole-3-acetic acid (IAA) Auxins • Auxein - to grow • First plant hormone discovered • Occurs in very low concentrations • Confers apical dominance • Regulates developmental processes, e.g. cell division, cell elongation etc Auxin – important for root development

  9. Cytokinins • Stimulates cell division • Lateral bud development • Delays senescence and promotes nutrient uptake Effect of cytokinin application on leaf senescence Rost et al., 1998

  10. Abscisic acid • ‘Abscisin II’- role in abscission • Released during desiccation (of vegetative tissue) • Produced in response to stress • Synthesized in green fruits and seeds • General growth inhibitor – inhibits fruit ripening ABA – The stress hormone www.ars.usda.gov/.../ jan01/acid0101.htm?pf=1

  11. Ethylene • Fruit ripening • Opening of flowers • Induces seed germination • Initiation of stem elongation and bud development Tomato Ethylene treated Banana

  12. Gibberellins • Ubiquitous in both flowering (angiosperms) and non-flowering (gymnosperms) plants as well as ferns • Many forms exist, named GA…GAn in the order of discovery

  13. Discovered in association with foolish seedling disease of rice (“Bakanae”) caused by the fungus, Gibberella fujikuroi. The fungus produces GA. Gibberellins uninfected infected Yabuta and Sumiki, 1938

  14. Gibberellins • Synthesized in the apical portions of both stem and roots • Important effect on stem elongation in plants • Application of gibberellins promotes internode elongation • Involved in many other aspects of plant growth www.school.net.th/.../ science/10000-6600.html

  15. - GA + GA Fewer flowers and larger fruits Delayed harvesting Increased fruit size GAs are commercially used for increased fruit size in table grapes and to regulate citrus flowering and rind maturation Fruit growth – seedless grapes Functions of gibberellins • Cell elongation • Seed germination • Flower induction • Breaking dormancy

  16. Gibberellin mutants • Elongated mutants – constitutive GA response(e.g. spy in arabidopsis)orenhanced GA response(e.g. lv in pea) • Dwarf mutants – three groups • Accumulate GA and mostly unresponsive to applied GA(e.g. gai in arabidopsis) • Reduced GA response but attain full responses with high doses of exogenous (added) GA(e.g. lgr in pea) • Reduced GA response but do not respond to the application of high doses of GA (e.g. lk and lkb in pea) Ross et al. 1997

  17. Dwarf mutants Normal rice (right) and the GA-deficient “superdwarf” mutant. A comparison of 28 day-old plant of the normal and Dwarf-1 mutant in bean Praona and Green, 1967

  18. Significance of GA mutants • Insight into GA biosynthesis and regulation • Help us understand plant growth and development • Sex determination in maize – creation of double mutants • Suitable for production in space…?

  19. GA-deficient “superdwarf” rice and normal wildtype plants – both types are 21 days old Superdwarf Wild type

  20. Physiological response The superdwarf mutation occurs in the late steps of GA synthesis. Other mutations occur at other steps, such as in a hormone receptor. These mutants are valuable tools in studying GA’s role in plant biology. What experiment could we do to distinguish between these two types of mutation, i.e., synthesis or response? Hormone synthesis Transport of hormone

  21. GA exerts its effects on wild type plants – seen here 6 days after treatment with 0 mg/ml or 10 mg/ml GA 0 mg/ml 10 mg/ml

  22. Superdwarf rice, 6 days after treatment with 10 microliters of 0, 1, and 10 mg/ml Gibberellic Acid (GA) 0 mg/ml 1 mg/ml 10 mg/ml

  23. GA-3-beta hydroxylase H GA20 inactive A hydroxylase is an enzyme that adds a hydroxyl group (-OH) to a substrate GA1 active

  24. The rice superdwarf mutant (also called Hosetsu-waisei dwarf from the original Japanese description) is caused by a change in the gene encoding a GA-3b-hydroxylase. NORMAL (wildtype) Superdwarf mutant Deletion of a G residue 5’ 5’ DNA messenger RNA transcription 5’ 5’ translation protein Normal, functional protein The deletion of a G causes a premature “stop” codon – so translation ends early and a full normal protein is not made

  25. Shown is a small portion of the rice GA 3b-hydroxylase gene. The G at nucleotide #750 of the gene is deleted in the superdwarf mutant. This causes a change in the amino acids that are encoded after that point. The letters above the DNA sequence are the one-letter abbreviations for the amino acids that are encoded by each triplet codon. absent in mutant Wildtype sequence V P G L Q L F R R G P D R W V A V P A V 721 gtcccggggctgcagctgttccgtcgagggcccgaccggtgggtggcggtgccggcggtg 780 A G A F V V N V G D L F H I L T N G R F 781 gcgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttc 840 H S V Y H R A V V N R D R D R V S L G Y 841 cacagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctac 900 Mutant sequence V P G L Q L F R R G P T G G W R C R R W 721 gtcccggggctgcagctgttccgtcgaggcccgaccggtgggtggcggtgccggcggtgg 780 R G P S S S T S A T S S T S S P T A A S 781 cgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttcc 840 T A S T T A P S * T A T A T G S R S A T 841 acagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctact 900 Premature “STOP” codon

  26. Using codon tables to determine amino acid sequences encoded by DNA 736 c t g t t c c g t c g a g g g c c c g a c c g g t g g mRNA cuguuccgucga _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A.A. LFRR _ _ _ _ _ C Y F L L I S P T A W H Q R S R N K M V D E G

  27. The experiment: Plant rice seeds – mutant and wildtype. Allow to germinate and then treat with GA at a young age. Can alter volume, concentration, location, plant age, plant species...

  28. These mutants, and others like them, have been considered for use in sustaining space travelers (see www.usu.edu/cpl) . What properties make these plants potentially useful for space travel? Mutant wildtype Plants of the same age

More Related