Dyskeratosis congenita

1. Dyskeratosis congenita Philip J Mason Departments of Internal Medicine and Genetics Washington University Medical School St Louis Missouri

2. Dyskeratosis congenita (DC) Different genetic forms - X-linked form and dyskerin - autosomal dominant form and anticipation Telomerase Variable expression of DC mutations - aplastic anemia - pulmonary fibrosis - leukemia Mouse models of X-linked DC - Dyskerin important in cell proliferation - Role of dyskerin in DNA damage response

3. Dyskeratosis congenita Skin pigmentation, nail dystrophy, mucosal leukoplakia

4. Dyskeratosis congenita Most patients have bone marrow failure, is responsible for death in 85% of cases Heterogeneous set of other abnormalities include pulmonary disease, short stature, learning difficulties, predisposition to malignancy Stem cell disorder Genetically heterogeneous

5. Malignancy Epithelial cancers of GI tract MDS/AML

6. Patterns of inheritance in DC DCR 108 DCR 039 DCR 070 DCR 073 DCR 101

7. Genetics of Dyskeratosis Congenita Autosomal recessive NOP10, NHP2, TERT Autosomal dominant TERT,TERC X-linked dyskerin 8% 4% 31% Unknown 46% 11% SporadicTINF2

8. X-linked DC locus within Xq28

9. X-inactivation in DC carriers HpaII HpaII - + - + - + (CAG)n Exon1 of Humara gene Xq12

10. Identification of a deletion in an X-linked DC patient

11. X-linked DC caused by mutations in DKC1 encoding dyskerin TruB PUA NLS NLS poly-lysine Dyskerin Human Rat NAP 57 Cbf5p Yeast Nop60B/mfl Drosophila

12. X-linked dyskeratosis congenita Hoyeraal-Hreidarsson syndrome polymorphisms * recurrent * * common recurrent de novo mutation Mutations in the DKC1 gene Q31K Q31E F36V L37de I38T K39E P40R E41K K43E T49M M350T M350I A353V** A353V T357A D359N P384L P384S A386T R65T T66A T67I H68Q L72Y L398P G402E G402R T408I P409L S420Y K314R L317F L321V R322Q * A2V S121G S280R 2kb deletion R158W P10L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 IVS2 473 C>G 1551G>A IVS1 +592C>G 1494 insAAG IVS6 +40T>G URR -142C>G IVS14 -72G>T 1461C>T

13. Clustering of Mutations in Dyskeratosis Congenita R. Rashid et al. Molecular Cell 2006

14. Dyskerin associates with H/ACA small nucleolar RNAs snoRNP NHP2P GAR1P H ACA dyskerin NOP10P

15. Dyskerin Dyskerin The Role of Dyskerin in Ribosome Biogenesis rDNA Pol I transcription 5’ ETS ITS1 ITS2 3’ ETS 47S Pre-rRNA 18S 5.8S 28S • Pre-rRNA modification Box H/ACA snoRNPs Y YYY YY 45S CH3 CH3CH3 CH3 CH3 CH3 41S Box H/ACA snoRNPs • Pre-rRNA processing 21S 32S 18SE 28S 12S 18S 5.8S Protein synthesis Ribosome assembly Mature ribosomes Pre-ribosomes

16. Telomerase RNA is a H/ACA snoRNA H/ACA snoRNA CR4-CR5 domain Telomerase RNA CR7 domain Hypervariable 5 ' paired region 3’ rRNA Pseudoknot domain 3’ H ACA 5’ 3’ H ACA Box H/ACA 5’ domain Template Box ACA Box H snoRNA ANANNA ACA hTERC AGAGGA ACA mTerc ACAGGA ACA

17. CR4-CR5 domain Pathogenic mutations small deletion bp change large deletion Polymorphism Box H/ACA domain Template Telomerase Mutations in Autosomal Dominant Dyskeratosis Congenita TERC TERT Pseudoknot domain 2001 2005

18. NOP10 and NHP2 mutated in rare autosomal recessive cases Walne et al 2007 - NOP10 homozygosity mapping in large consanguineous family - affected members have mutation in conserved aa NHP2 - 3 mutations found by sequencing Vulliamy et al 2008 None found in GAR1

19. Mutations in TINF2 cause severe DC Savage et al 2008 Found mutation in TINF2 in family with AD DC. Then found them in 4 of 8 AD DC probands with no mutations in DKC1, TERT or TERC Walne et al 2008 found TINF2 mutations in 33/175 previously uncharacterized cases of DC Severe Nearly all de novo Tightly clustered - 21 affect residue R282 (14H and 7C) all within 18aa.

20. Dyskerin associates with H/ACA snoRNAs and Telomerase RNA (hTERC) Telomerase RNP snoRNP others TERT NHP2P dyskerin GAR1P dyskerin NHP2P NOP10P NOP10P GAR1P

21. DC due to deficiency of telomerase or rRNA processing? Telomeres Ribosomes Dkc1m mutant mice Hypomorphic mutant causes decreased production of dyskerin due to transcriptional interference - ribosome defects and some features similar to DC Other BMF syndromes Diamond Blackfan RPS19 Schwachman Diamond SBDS- nucleolar protein associated with snoRNAs and ribosomal proteins. Cartilage Hair Hypoplasia - mutations in RNA component of RNAse MRP involved in 5.8S rRNA processing Dyskerin mutants in other species Mutations in yeast and Drosophila cause slow growth and ribosome defects - no association with telomerase AD disease due to telomerase RNA All DC patients have very short telomeres Telomerase activity and TERC levels decreased in DC Dyskerin stabilizes TERC TINF2 mutations cause DC mTR-/- mice similar to DC Late generation mice have features of DC

22. 20 14 90% 75% 50% 25% 10% 100 80 Patients with Dyskeratosis Congenita and Bone Marrow Failure have Very Short Telomeres (Flow FISH) TERC mutations, n=11 18 DYSKERIN mutation, n=3 DC no mutation, n=3 16 Relative Telomere Length (% 4n Cell Line) 12 10 8 6 4 2 0 0 20 40 60 Age (years)

23. Telomerase Important in maintaining chromosome ends - solution to end- replication problem Telomeres are DNA/protein structures at the ends of chromosomes, needed to protect chromosome end from degredation and distinguish them from double stranded breaks. Telomere DNA consists of thousands of repeats of TTAGGG Low levels in most somatic cells - higher in stem cells, cancer cells, germ cells In somatic cells telomeres get shorter with each cell division

24. The end replication problem 3’ leading strand 5’ 3’ lagging strand 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’

25. Telomerase action TTAGGGTTAGGGTTAGGGTTAGGGTTA 3’ parental strand AATCCC 5’ lagging strand ATCCCAAT telomerase reverse transcriptase (TERT) TTAGGGTTAGGGTTAGGGTTAGGGTTA 3’ AATCCC 5’ telomerase RNA (TERC) ATCCCAAT TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA 3’ AATCCC 5’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA 3’ AATCCC ATCCCAATCCCAATCCCAATCCCAA 5’ DNA POLYMERASE

26. Telomere Structure

27. Telomerase, senescence and cancer Germ cells (telomerase+) Telomere length Stem cells (telomerase+) Somatic cells (telomerase-) p53- Tumor cells (telomerase+) replicative senescence senescence crisis Cell replication

28. Summary of DC mutations

29. DCR 063 DCR 082 39 52 30 10 12 Inheritance of short telomeres - Anticipation • diagnosis made at made at younger age in succeeding generations • asymptomatic • raised HbF • high MCV Classical DC incl BMF DCR 101 • asymptomatic • hair loss/greying • borderline neutropenia 68 47 48 37 46 40 29 22 17 3 9 13

30. Asymptomatic parents of AA patients also carry hTERC mutations • high MCV • mild anaemia • high MCV • high HbF 61 Thrombocytopenia 9 72 C->G 60 Pancytopenia Elphic appearance pancytopenia 20 20 normal 110-113 del GACT asymptomatic carrier aplastic anaemia

31. Anticipation by shortening telomeres

32. Anticipation in family with TERT mutation Armanios et al 2005

33. Telomerase mutations and pulmonary fibrosis Armanios et al 2007 73 probands from familial PF registry 6 (8%) had TERT (%) or TERC (1) mutations Tsakiri et al 2007 Mapped causative gene to TERT in 2 families with PF Screened another 44 families with PF and 44 patients with IPF. 4TERT 1 TERC 1TERT Primary presentation was PF - some had mild anemia but no features of DC

34. Telomere length, telomerase mutations and IPF PF patients have short telomeres that cannot all be accounted for by known mutations Cronkhite et al 2008

35. TERT mutations and Leukemia Calado et al 2008 PNAS 8% AML had TERT mutations decreased telomerase activity 6 had A1062T – 3.8X higher frequency than in normals but same as CEPH collection! ASH 2008 not published 10% CLL had hypomorphic TERT mutations

36. Mouse models of X-linked DC - Rationale Make dyskerin mutations in mice that are copies of human mutations Mice have very long telomeres - complete absence of telomerase - no abnormalities in early generations - get DC - like effects after 3 or more generations So effects in early generations should not be due to telomerase defects Telomerase defects should be seen after in later generations or after crossing with short telomere mice

37. Targeting construct - Del15 1 0 1 1 1 2 1 3 1 4 15 MPP1 IRES neo EcoRI BamHI BamHI HindIII G G A T G G G G T A T G T G T G A A C C A T G G A Asp Gly Val STOP

38. Telomerase and snoRNAs in wild type and Del15 ES cells snoRNAs TRAP Telomeres

39. Proliferative disadvantage of cells expressing the 15 dyskerin protein in aging Dkc1+/D15 heterozygous female mice.

40. Etoposide treatment induces an enhanced ATM-p53/p21 dependent DNA damage response in Dkc1D15 MEF cells

43. 15 MEFs accumulate more Double strand breaks Increased in high oxygen 7 6 P D 2 5 P D 6 H2AX foci/cell 4 P D 1 2 3 P D 2 5 2 g- 1 0 W T 3 % O 2 1 5 3 % O 2 W T 2 1 % O 2 1 5 2 1 % O 2 D D

44. 15 mice show increased DNA damage response Liver Spleen BM -H2AX p53 -Actin WT 15 WT 15 WT 15

45. Increased DNA damage response is related to ageing Spleen 4 M 12 M 17 M -H2AX -H2AX -Actin WT 15 WT 15 WT 15

46. N-Acetyl-l-Cysteine (NAC) • NAC is a derivative of the dietary amino acid l-cysteine. • NAC has a high affinity for lung tissue, which it supports through mucolytic and antioxidant action. • NAC also enhances glutathione production and plays a role in heavy metal detoxification

47. NAC can partially rescue the growth disadvantage in female D15/+ MEF cells PD 1 3 7 11 15 NAC - NAC + 100µM

48. NAC + NAC - 3 weeks 12 weeks NAC can partially rescue the growth disadvantage in female mice 1mg/ml in drinking water

49. Summary Dyskerin is essential for cell proliferation but not for cell survival Dyskerin mutation causes slow growth due to a telomerase dependent increase in DNA damage at the telomere end - this is independent of telomere length Hematopoietic stem cells with a dyskerin mutation have a functional defect that increases with age The growth defect can be partially rescued with antioxidant