nodin
Uploaded by
1 SLIDES
137 VUES
10LIKES

Designing a Biomolecular Transducer with Superior Computing Capabilities

DESCRIPTION

Explore a novel approach to biomolecular computing with a transducer model, allowing for advanced computing potential. Incorporating plasmids, multiple computations can be performed consecutively. Discover the innovative divide-by-two and divide-by-three automata created in this project for enhanced computational abilities.

1 / 1

Télécharger la présentation

Designing a Biomolecular Transducer with Superior Computing Capabilities

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. S0 r0p0 S0S0 r2p1 S0S0 r1p0 S1S1 r1p2 S0S1 r0p1 S1S1 r2p2 S1 B. A. r 2 p 0 r 2 p 1 r 1 p 0 Figure 4 S1 S0 S2 r 2 p 2 r 0 p 0 r 0 p 1 r 1 p 2 r 1 p 1 r 0 p 2 0 1 2Terminator AGTCTT GGTATT CTCGTT TGCTGA TCAGAACCATAA GAGCAA ACGACT AGTCTT GGTATT CTCGTT TGCTGA AAAA AA CT GTCTT GTATT TCGTT GCTGA AA A T TCTTTATT CGTT CTGA Sequences decided upon for each symbol Sticky ends left by sequences cleaved in S0 Sticky ends left by sequences cleaved in S1 Sticky ends left by sequences cleaved in S2 S0 r0p0 S0S0 r1p0 S1S0 r2p0 S2 S2 r0p2 S0S2 r1p2 S1S2 r2p2 S2 S1 r0p1 S0S1 r1p1 S1S1 r2p1 S2 EagI Recognition Site (18 in base ten) BbvI Recognition Site Spacers 200Terminator BseRI Recognition Site AATTCGGCCGTT..8 base..CTCCTCGCAGC..8 base..CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAA..pairs ..GAGGAGCGTCG..pairs ..GAGCAATCAGAATCAGAAACGACTTTAA D BbvI BseRI BbvI BseRI Plasmid + + A B AATTCGGCCGTT CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAATCAGAAACGACTTTAA + All DM + All TM C AATTCGGCCGTTAGTCTT..8 base..CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA..pairs ..GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA AATTCGGCCGTTAGTCTT TCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAG TCAGAAACGACTTTAA AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGCTTTAA AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA Challenging Traditional Approaches to Computation: A Biomolecular Transducer Employing Ternary Language and Rendering a Biological Output Paul Lazarescu and Mark Chaskes Mentor: Tamar RatnerThe Schulich Faculty of Chemistry, Technion-Israel Institute of Technology Design and Development Molecules Design Abstract Figure 3: The divide-by-two transducer used in this project. The transduer begins in state 0 (S0). A. A schematic diagram ofthe transducer. 'r' represents the 'read' symbol and 'p' represents the 'printed‘ symbol. B. Transition rules of this transducer. For each transition rule there is a transition molecule. Transition Molecules (TM) S0 to S0, read 0, print 0 S0 to S1, read 1, print 0 S0 to S2, read 2, print 0 S1 to S0, read 0, print 1 S1 to S1, read 1, print 1 S1 to S2, read 2, print 1 S2 to S0, read 0, print 2 S2 to S1, read 1, print 2 S2 to S2, read 2, print 2 r 2 p 1 A. B. r 0 p 1 Biomolecular computing is a new field of research, merging several sciences. Previous works were based on finite state automata and have had limited computing capabilities. In this project, a transducer model was used in order to design a biomolecular machine with greater computing potential. In this research, two automata were designed as software for the transducer: one able to divide a ternary input by three and the other by two. By making use of a plasmid this transducer could perform multiple computations consecutively. r 1 p 0 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...TCAG 0 BseRIBbvI S1 S0 r 1 p 2 r 2 p 2 AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...CCAT r 0 p 0 Figure 3 AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CAGA GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CATA Figure 4: The divide-by-three transducer used in this project. A. A schematic diagram of the transducer. ‘r’ represents the ‘read’ symbol and ‘p’ represents the ‘printed’ symbol. B. Transition rules of this transducer. GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...AGCA A. B. CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...AGAA Introduction Terms CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...ATAA Figure 5:A. The state of the transducer depends on the way the symbol was cleaved. B. The symbols cleaved in different states leaving unique sticky ends DNA (Fig. 1): double strand molecule. Made of base pairs: cytosine (C) only bonds to guanine (G), and adenine (A) only bonds to thymine (T). CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...GCAA Figure 8: The TM for the divide-by-three transducer. For every transition rule of the transducer, one transition molecule had to be designed. Another six transition molecules were created for the divide-by-two transducer. Figure 5 Results Figure 1[1] Detection Molecule (DM) Input (divide-by-three transducer) DNA Based Automaton (Fig. 2): a model that can ‘read’ DNA symbols and change it’s state according to the read data. DNA Based Transducer: a more complex version of an automaton, that can both ‘read’ and ‘print’ information using double-stranded DNA (dsDNA). Restriction Enzyme Type II (Fig. 2A): cleaves dsDNA at a certain distance from a recognition site. DNA Ligase (Fig. 2A): covalently bonds different fragments of dsDNA to each other. Sticky End (Fig. 2C): unpaired single strand DNA (ssDNA) overhangs. These sequences bond to other DNA sticky ends with complementary base pair sequences. Plasmid: a circular vector found in bacteria, in which a foreign DNA sequence is easily inserted. Figure 9: The DM bonds with the cleaved terminator. These molecules instigate a biological function (releasing a drug, giving a bacterial TGCTGA...Reporter... AAACGACT....Gene 0....ACGA TGCTGA...Reporter... AAACGACT....Gene 1....CGAC TGCTGA...Reporter... AAACGACT....Gene 2....GACT Figure 9 phenotype output, etc.) and print the terminator symbol to continue the computation. First cut by restriction enzymes Discussion Two software for a DNA based transducer were created. A variety of molecules were also designed as the components of the transducers. The models and the molecules were simulated and checked using a computer program. The molecules were processed and functioned as expected, and the design worked properly. Creating a biomolecular transducer has not yet been accomplished experimentally. However, this science can have many applications. (S0,2) First Ligation addition of transition molecule S0 to S2­ (read 2, print 0) Figure 2[2] Second Cut Repeat cycle of restriction, hybridization, and ligation until the terminator is cleaved Final Cut Conclusions In the future biomolecular computers will hopefully integrate into biological systems. Because these machines are capable of a biological output, this project is literally cutting-edge science. These devices are unlikely to replace the common computer. Instead, due to their capability for direct interface, the importance of biomolecular computing lies within the integration of biological systems, in fields ranging from medicine to agriculture. (S0,T) Final Ligation bonding of detection molecule to sticky ends of terminator 020Terminator Terminator Reporter Gene 0 inserted and can be expressed by bacteria, or, a second computation can occur. Figure 6 [1] Adapted from the National Human Genome Project [2] M. Soreni, S. Yogev, E. Kossoy, Y. Shoham, E. Keinan, Parallel Biomolecular Computation on Surfaces with Advanced Finite Automata. J. AM. CHEM. SOC. 127, 3935-3943 (2005). Figure 6: An example of a computation process on an input string of ‘200’ (equivalent to 1810), using the DNA based transducer that divides by three. Acknowledgements: We would like to sincerely thank our mentor Tamar Ratner for her dedication, as well as Professor Ehud Keinan for allowing us to use his laboratory. We also would like to thank Mr. Russell N. Stern and the Louis Herman Israel Experience Fund for their generosity and donation.

More Related