nowles
Uploaded by
22 SLIDES
358 VUES
220LIKES

Access Command-Line Analysis Tools via SOAP Services with Soaplab

DESCRIPTION

Soaplab provides a robust framework for accessing command-line analysis tools over the Internet using SOAP web services. Designed for users seeking to integrate analysis tools into their applications, Soaplab facilitates interaction with command-line tools remotely. The process includes describing your command-line tool, converting specifications to XML, and deploying web services. Developers can create their own client programs or utilize existing ones to access a variety of analysis services, ensuring seamless integration and functionality in data analysis workflows.

1 / 22

Télécharger la présentation

Access Command-Line Analysis Tools via SOAP Services with Soaplab

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. SoaplabSOAP-based Analysis Web Services Martin Senger <senger@ebi.ac.uk> http://industry.ebi.ac.uk/soaplab

  2. What is the task? • You have (or someone else has) one or more command-line analysis tools • You want to access them from other computers, eventually over an Internet • You want to access them using your (or someone else’s) programs, not just by filling the forms and clicking on web pages

  3. How it fits with the rest of the world • Phase 1: Describe your command-line tool (preferable using an ACD file) • http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Acd/index.html • Phase 2: Soaplab • this whole presentation is about this phase • Phase 3: Write your own programs (GUIs and others) to access tools via Soaplab • part of this presentation is about this • Taverna: an example of a workflow system using Soaplab (and other) web services as components

  4. What Web Services are in Soaplab? • By resources that are being accessed: • command-line tools (sub-project: AppLab) • web pages (sub-project: Gowlab) • By results that are being delivered: • Analysis/Gowlab Factory Service (misnomen) • produces a list of all available services • Analysis Service • represents one analysis tool and allows to start it, to control it, and to exploit it, or it represents a remote web page accessible using the same API as other Soaplab analysis services • does it in loosely type manner using the same API for all analysis • Derived Analysis Service • does the same as the Analysis Service above but in a strongly typed manner having individual API for any individual analysis tool

  5. Create analysis description Convert to XML Start AppLab server Start Tomcat server This is Soaplab  Deploy Web Services  Use existing client, or/and write your own client Tomcat (or any servlet engine) Provided ready clients Apache Axis (SOAP Toolkit) Soaplab services Talisman Your own client programs XML (analysis description) XML (analysis description) XML (analysis description) XML (analysis description) XML (analysis description) ACD (analysis description) BioPerl modules (Bio::Tools::Run::Analysis) Graphically…      MySQL with results  acd2xml (convertor) Files: IOR/analyses/… Filesystem with analysis results AppLab server  • Important: • how to write ACD • what API to use • by the clients Command-line driven analysis tools Downoad: soaplab-clients-version Binary distribution Downoad: applab-cembalo-soaplab-version (for EMBOSS) Downoad: analysis-interfaces-version http://industry.ebi.ac.uk/soaplab/dist/

  6. Create web resource description Convert to XML Start AppLab server Start Tomcat server This is Soaplab  Deploy Web Services  Use existing client, or/and write your own client Tomcat (or any servlet engine) Provided ready clients Apache Axis (SOAP Toolkit) Soaplab services Talisman Your own client programs XML (analysis description) XML (analysis description) XML (analysis description) XML (analysis description) ACD (analysis description) XML (analysis description) BioPerl modules (Bio::Tools::Run::Analysis) Or…      MySQL with results  acd2xml (convertor) Gowlab classes Filesystem with “analysis” results  • Important: • how to write ACD • what API to use • by the clients Remote web resources (web pages) Downoad: soaplab-clients-version Binary distribution Downoad: analysis-interfaces-version http://industry.ebi.ac.uk/soaplab/dist/

  7. Downoad: soaplab-clients-version http://industry.ebi.ac.uk/soaplab/dist/ A. Client developer • Needs to know the Soaplab API • Can develop in any programming language • Needs to know a place (an endpoint) with a running Soaplab services • http://industry.ebi.ac.uk/soap/soaplab(EMBOSS) • Can use the ready, pre-prepared Java and Perl clients

  8. The List (factory) service An example of (additional) methods for a derived service The main methods for running an analysis getAvailableAnalyses() getAvailableCategories() getAvailableAnalysesInCategory() getServiceLocation() createEmptyJob() set_sequence_usa (datum) set_format (datum) set_firstonly (datum) … get_report() get_outseq() createJob (inputs) run() waitFor() getResults() destroy() getSomeResults() createAndRun (inputs) runAndWaitFor (inputs) The methods for asking about the whole analysis The methods for asking what is happening getStatus() getLastEvent() getCreated() getStarted() getEnded() getElapsed() getAnalysisType() getInputSpec() getResultSpec() getCharacteristics() describe() Soaplab APIhttp://industry.ebi.ac.uk/soaplab/API.html

  9. Once you know API… import org.apache.axis.client.*; import javax.xml.namespace.QName; import org.apache.axis.AxisFault; import java.util.*; Call call = null; try { // specify what service to use call = (Call) new Service().createCall(); call.setTargetEndpointAddress ("http://industry.ebi.ac.uk/soap/soaplab/display::showdb"); // start the underlying analysis (without any input data) call.setOperationName (new QName ("createAndRun")); String jobId = (String)call.invoke (new Object[] { new Hashtable() }); // wait until it is completed call.setOperationName (new QName ("waitFor")); call.invoke (new Object[] { jobId }); // ask for result 'outfile' call.setOperationName (new QName ("getSomeResults")); Map result = (Map)call.invoke (new Object[] { jobId, new String[] { "outfile" } }); // ..and print it out System.out.println (result.get ("outfile")); } catch (AxisFault e) { AxisUtils.formatFault (e, System.err, target.toString(), (call == null ? null : call.getOperationName())); System.exit (1); } catch (Exception e) { System.err.println (e.toString()); System.exit (1); }

  10. Once you know API… • Direct usage of the Soaplab API… • …or using BioPerl modules use SOAP::Lite; my ($soap) = new SOAP::Lite -> proxy ('http://industry.ebi.ac.uk/soap/soaplab/display::showdb'); my $job_id = $soap->createAndRun()->result; $soap->waitFor ($job_id); my $results = $soap->getSomeResults ($job_id, ['outfile'])->result; print $results->{'outfile'} . "\n"; use Bio::Tools::Run::Analysis; print new Bio::Tools::Run::Analysis (-name => 'display::showdb') ->wait_for ( {} ) ->result ('outfile');

  11. What names to use for inputs? • Ask getInputSpec() • some inputs are mutually exclusive (but Soaplab does not tell you ) • supported types: basic types • And the results? Ask getResultSpec() • expected types: basic types, byte[], byte[][] • better check org.embl.ebi.SoaplabClient.AxisUtils.aa2bb()

  12. Downoad: soaplab-clients-version http://industry.ebi.ac.uk/soaplab/dist/ What else… • Code examples at: • http://industry.ebi.ac.uk/soaplab/UserGuide.html • Play also with existing clients: run-analysis-client –h run-factory-client –h run-registry-client –h run-tutorial

  13. Downoad: applab-cembalo-soaplab-version (for EMBOSS) http://industry.ebi.ac.uk/soaplab/dist/ Downoad: analysis-interfaces-version http://industry.ebi.ac.uk/soaplab/dist/ B. Service provider • EMBOSS provider • contains pre-generated XML files for all EMBOSS analysis (but not EMBOSS itself) • Provider of your own analysis tools • contains for creating XML files acd2xml (convertor)

  14. Installation • Run perl INSTALL.pl • and you will be asked many questions • or prepare your answers in environment variables and run: perl INSTALL.pl –q • Do you want to add your analyses? • write an ACD file (e.g. metadata/bigdeal.acd) • run: generator/acd2xml –d –l MyApps.xml bigdeal • see generator/README for details

  15. What questions to expect? basics JAVA_HOME where is Java installed PROJECT_HOME where is everything unpacked RESULTS_URL URL pointing to the server-side results tomcat and axis locations TOMCAT_HOME directory where is a Tomcat servlet engine TOMCAT_URL URL accessing Tomcat (e.g. http://localhost:8080) AXIS_IN_TOMCAT directory where Axis is installed under TOMCAT mySQL locations (the whole mySQL stuff is, however, optional) MYSQL_URL location of mySQL Soaplab database MYSQL_USER username of mySQL Soaplab database MYSQL_PASSWD password for mySQL Soaplab database rarely needed, only for your own analyses ADD_TO_PATH will be added to PATH before the AppLab server starts nothing to do with web-services (so ignore it…) ALWEB_SCRIPTS_URL where are alweb cgi-bin scripts ALWEB_DOCS_URL where are alweb related documents

  16. And run it! • ./run-AppLab-server • check AppLabServer.log • (start your Tomcat) • ./ws/deploy-web-services • try any client • check soaplab.log • …complain tosenger@ebi.ac.uk

  17. Deploying services • That can be tricky…because it includes many things: • move your classes to Tomcat • create service descriptors (files *.wsdd) • generate and compile code for the derived services • etc. • Therefore, use a Soaplab admin client: • run-admin-client –help • which is used by ws/deploy-web-services, anyway

  18. Practical session

  19. A. Main steps • Download various Soaplab distributions • Try several ready clients • Code your own client (calling EMBOSS at EBI) • Run Soaplab on top of your own EMBOSS installation on your machine • Code your own ACD file and run Soaplab service on top of it

  20. Code your own client • Calling EMBOSS at EBI: • class Seqret.java • usage:java Seqret [format] < input_sequence > reformatted_sequence • where format represents output sequence format and is used as parameter osformat, and input_sequence is used as parameter sequence_direct_data or sequence_usa (check for double colon) • check it by calling: • java Seqret ncbi < embl:v08008 • it does the same as: >gnl|embl|MMIGK7 (V00808.1) Part of the murine gene for kappa-immunoglobulin leader peptide and variable part (cell line MOPC41). cgtgaccaatcctaactgcttcttaataatttgcataccctcactgcatcgccttgggga cttctttatataacagtcaaacatatcctgtgccattgtcattgcagtcaggactcagca tggacatgagggctcctgcacagatttttggcttcttgttgctcttgtttcaaggtaaaa tgaaacttaaaattgggaattttccactgtttccaactgtggttagtgttgactggcatt tgggggatgtcctcttttatcatgcttatctatgtggatattcattatgtctccactcct aggtaccagatgtgacatccagatgacccagtctccatcctccttatctgcctctctggg agaaagagtcagtctcacttgtcggccaagtcaggacattggtagtagcttaaactggct tcagcaggaaccagatggaactattaaacgcctgatctacgccacatccagtttagattc tggtgtccccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcag cagccttgagtctgaagattttgtagactattactgtctacaatatgctagttctccgtg gacgttcggtggaggcaccaagctggaaatcaaacgtaagtagaatccaaagtctctttc ttccgttgtctagtctgtgtctatg run-analysis-client -e http://industry.ebi.ac.uk/soap/soaplab \ -name edit::seqret \ -w -r outseq –q \ sequence_usa embl:v00808 osformat ncbi

  21. Run Soaplab on top of your EMBOSS • Install EMBOSS • Install the rest  • run AppLab and Tomcat servers • deploy Soaplab services • check with Soaplab and your clients

  22. Add your own analysis • add a “real” analysis • cal [–m] [–j] [–y] [[month] year] • write an ACD file • convert it to XML, create MyApp.xml • edit run-AppLab-server script • restart AppLab and Tomcat server • deploy: • ws/deploy-web-services –n cal –l • try by: ws/run-analysis-client • add a Gowlab-based resource

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer