Investigating the Interactions of miR-107 and miR-16 with BACE1 through Co-IP and qPCR
This study examines the interactions between miR-107 and BACE1 using co-immunoprecipitation (Co-IP) techniques and downstream qPCR analysis. By performing biological replicates (n=3) and analyzing lysate post-transfection with miR-107 and a negative control, we report significant interactions (p
Investigating the Interactions of miR-107 and miR-16 with BACE1 through Co-IP and qPCR
E N D
Presentation Transcript
Nelson, PT_Suppl_Fig3 Lysate Co-IP after transfections * ** ** GRN GRN BACE1 BACE1 n=3 biological replicates each MiR-107 v NEG-CTRL *-p<0.01; **-p<0.0001
Nelson, PT_Suppl_Fig4 A 13 miR-107* 35 c c --c uuc u a ucu ugcuuu agcucuuacaguguugcuug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaa ucgg ga auguuacgacg aac uug g c cua - c - - a 72 miR-107 50 5’ 3’ Homo sapiens miR-107 stem-loop B u u c agcu cu uacaguguugc uugmiR-107* |||| || ||||||||||| | ucgg ga auguuacgacg a miR-107 acua - c- 5’ 3’ 5’ 3’ miR-107 duplex for transfection D C Anti-AGO co-IP with downstream qPCR
Nelson, PT_Suppl_Fig5 Y axis: # miR-16 seed sequences/1000 nts in 5’utr, CDS, and 3’UTR A X axis: miR-16 targets sorted by enrichment in AGO co-IP (50 mRNAs/grp) 1 1000 2000 3000 B X axis: miR-16 targets sorted by mRNA lysate “knock-down” (50 mRNAs/grp) 1 1000 2000 3000
