Understanding DNA Fingerprinting: Techniques and Applications for Forensic Science
DNA fingerprinting is a powerful forensic technique based on the unique genetic makeup of individuals. It targets variable number tandem repeats (VNTRs) in non-coding regions of DNA, which differ from person to person. By analyzing multiple loci containing these repeats, forensic scientists can achieve a match probability of less than one in a billion. DNA samples from crime scenes are purified and compared to samples from suspects through methods like PCR and gel electrophoresis, aiding in criminal investigations, paternity tests, and genetic disease studies.
Understanding DNA Fingerprinting: Techniques and Applications for Forensic Science
E N D
Presentation Transcript
DNA Fingerprinting: • The DNA of every individual is different. Loci where the human genome differs from individual to individual are called polymorphisms. • Polymorphisms may be different alleles of a gene (different base-pair sequences), such as the ABO human blood group multiple alleles. • Some polymorphisms are genes that exist in variable copy number. • Other polymorphisms are non-coding DNA that varies in both base-pair sequence and copy number, e.g. tandem repeats. • Tandem repeats are short DNA sequences that are non-coding and repeat at specific loci a variable number of times. Both the sequence and the copy-number of these repeats vary from individual to individual. These are the polymorphisms targeted by DNA fingerprinting. E.g. there is a region of DNA just beyond the insulin gene on chromosome 11, consisting of 7 to 40 repeats, depending on the individual. E.g. TCATTCATTCATTCATTCAT is a short tandem repeat (STR) of 4 base pairs that repeats 5 times at the locus shown. • Ten or more different loci containing similar variable number tandem repeats are tested, ensuring that the odds of a coincidental match are less than one in a billion or even one in a trillion. These tandem repeats are used since the whole human genome would be too much to analyse! • Procedure of DNA Fingerprinting in a forensic setting: • A DNA sample must be obtained from the crime scene, e.g. a sample of spilt blood. If the sample is large enough then DNA can be purified in sufficient quantities, if the sample is too small then PCR must be used to amplify the DNA in the sample. • The purified DNA is cut by restriction endonucleases at either side of several loci containing variable number tandem repeats (VNTRs). If the DNA has been amplified by PCR then rather than restrict the DNA, it is possible to use primers for DNA either side of these VNTR loci to only amplify these portions of DNA. • Obtain DNA from the victim and from the suspects by taking blood samples. Restrict or amplify these samples to obtain the same VNTR loci in these people. • Separate the various VNTR DNA sequences obtained from each person by gel electrophoresis. Use markers – DNA fragments of known and decreasing length. Also use a control – DNA that has been fingerprinted before, to make sure that the markers are reliable. DNA from the technician may also be tested as an internal control in case of DNA contamination. • Compare the DNA fingerprints of each suspect with the DNA sample from the crime scene. If DNA from one of the suspects exactly matches the sample DNA then a match ahs been obtained.
DNA Fingerprinting Exercise: Blood found at a murder scene is thought to be that of the attacker (there was a vicious fight and the attacker did not got away unscathed!). We have three suspects. Carry out a DNA fingerprint on blood samples from each suspect and on blood found at the scene. We are going to use restriction endonucleases and for simplicity we will only test two loci (we aren’t really bothered about catching the real murderer, just so long as we get a conviction!). Solve the crime! 1. Restrict each DNA sample with the following restriction endonucleases: ECORI —G—A—A—T—T—C— and Hind III —A—A—G—C—T—T— —C—T—T—A—A—G——T—T—C—G—A—A— And calculate the fragment sizes in bp. Suspect one has been done for you already: 29 bp fragment -GGCTACTGGAAGCTTAATGTCGGTCGGTCGGTCGGTCGTTCGAATTGCATGGGCG- -CCGATGACCTTCCAATTACAGCCAGCCAGCCAGCCAGCAAGCTTAACGTACCCGC- -GGCTATGGAATTCGGGTATAGTATAGTATAGCCAAGCTTGCTATTGCCCTGAGGCC- -CCGATACCTTAAGCCCATATCATATCATATCGG TTCGAACGATAACGGGACTCCGG- 26 bp fragment Suspect 2: -CTGGAAGCTTGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCTTCGAAT- -GACCTTCGAACCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGAAGCTTA- -TTGAATTCATCGATTAATTAATTACCAAGCTTGCTATTGCCC TGAGGCCGCTATGCT- -AACTTAAGTAGCTAATTAATTAATGGTTCGAACGATAACGGGACTCCGGCGATACGA- Suspect 3: -ATTGATTGATGGCTACTGGAAGCTTAACTAACTAACTGCTTCGAATTGCATCGGCG- -TAACTAACTACCGATGACCTTCGAATTGATTGATTGACGAAGCTTAACGTAGCCGC- -TACCTTAAGCATACATACATACATACATACATACATACATACATACATACAATTCGAA- -ATGGAATTCGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTTAAGCTT-
2. Plot the position the fragments would take on the following electrophoretic gel. The blood found at the scene has already been done for you: Base Pairs (markers) Crime scene Suspect 1 Suspect 2 Suspect 3 50bp 40bp 30bp 20bp 10bp 3. Which suspect do you think committed the murder? • Uses of DNA fingerprinting: • To test whether or not parents carry a disease-causing mutation that may be passed on to their offspring, e.g. sickle-cell disease, cystic fibrosis. • To determine the real father of a child (paternal testing). • To test crime suspects to see if their DNA matches that found at the crime scene. • Problems with DNA fingerprinting: • False Negatives: mistakenly declaring that there is no match. • False Positives: mistakenly declaring that there is a match. Is this an acceptable error? • Although the probability of two people coincidentally having matching DNA fingerprints is extremely small, the process of obtaining a DNA fingerprint by gel electrophoresis is prone to experimental error. The same DNA sample will never give two identical gels!