1 / 7

Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris

LABORATORY VALIDATION OF TWO REAL TIME RT-PCR METHODS FOR FOOT-AND-MOUTH DISEASE VIRUS WITH AN INCREASED DIAGNOSTIC SPECIFICITY. Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris. 22 October 2015. GFRA Scientific Meeting, Hanoi, Vietnam. Introduction: rRT-PCR for FMDV.

Télécharger la présentation

Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. LABORATORY VALIDATION OF TWO REAL TIME RT-PCR METHODS FOR FOOT-AND-MOUTH DISEASE VIRUS WITH AN INCREASED DIAGNOSTIC SPECIFICITY Vandenbussche Frank, Lefebvre David, De Leeuw Ilse, De Clercq Kris 22 October 2015 GFRA Scientific Meeting, Hanoi, Vietnam

  2. Introduction: rRT-PCR for FMDV • 5’-UTR rRT-PCR

  3. Introduction: rRT-PCR for FMDV • 3D rRT-PCR Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney KL, Rock DL, Nelson WM. J Am Vet Med Assoc. 2002 Jun 1;220(11):1636-42. • Evaluation of the 5’-UTR and 3D rRT-PCRs

  4. Validation of the 5’-UTR and 3D rRT-PCRs at CODA-CERVA (ISO 17025 accreditation) • Excellent results for each assay for: • Analytical sensitivity and specificity • Repeatability and reproducibility • Linearity of the PCR • Diagnostic sensitivity and specificity using reference samples • Field samples negative for FMDV: regularly Cp 38-45 (doubtful result)

  5. General principle demonstrated for the FMDV 3D forward primer 5’-ATATATATATATACTGGGTTTTACAAACCTGTGA … ..............TGACCCAAAATGTTTGGACACT… ATATATATATATACTGGGTTTTACAAACCTGTGA………………….. TATATATATATATGACCCAAAATGTTTGGACACT… ATATATATATATACTGGGTTTTACAAACCTGTGA………………….. ATATATATATATACTGGGTTTTACAAACCTGTGA … TATATATATATATGACCCAAAATGTTTGGACACT…

  6. Results for the diagnostic specificity using field samples • Negative sheep serum (N=382) • Negative cattle serum (N=372) • Negative pig serum (N=372) • 1 of the 1126 negative samples yielded a false-positive test result in the 3D/IC/EC rRT-PCR (Cp 39.78) with the cut-off value for positive set at Cp 40. • No false-positive test result was observed in the 5’-UTR/ IC/EC rRT-PCR. • No doubtful test results (Cp 40-50) were observed in neither of the two rRT-PCRs.

More Related