110 likes | 191 Vues
Team Conoscenza. Bioinformatics. Tan Jian Wei ~ Tan Fengnan. Presentation Flow. Background Problem Solution Technical Difficulties Milestones Questions. Background. Human Genome Project Began 1990 – Ended at 2004 Mapped out all of the Human Genome Sequences
E N D
Team Conoscenza Bioinformatics Tan Jian Wei ~ Tan Fengnan
Presentation Flow • Background • Problem • Solution • Technical Difficulties • Milestones • Questions
Background • Human Genome Project • Began 1990 – Ended at 2004 • Mapped out all of the Human Genome Sequences • 20,000 – 25,000 “working” gene • 3.3 Billion base pairs • Adenine, Thymine, Guanine, Cytosine • The base pairs will form proteins or hormones after a process known as “Transcription” Background Problem Solution Technical Difficulties Milestones Questions
Background Part 2 • Why do we want to do that? • We don’t actually know what this particular gene does. • Useful gene denotes a functionality or a trait • By comparing with isolated protein, we can find out where is exactly these genes are and does. • Example: Insulin • Insulin -> isolated from human • Do a base pair match against a genome database of a plant • Find out whether the plant can be candidate to produce a insulin substitute Background Problem Solution Technical Difficulties Milestones Questions
Background Part 3 • How do we do this? • United States National Center For Bioinformatics Information • BLAST (Basic Local Alignment Sequencing Tool) Background Problem Solution Technical Difficulties Milestones Questions
Background Part 4 AACGTTTCCAGTCCAAATAGCTAGGC ===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC Hits(+1): 18 Misses (-2): 5 Gaps (existence -2, extension -1): 1 Length: 3 Score = 18 * 1 + 5 * (-2) – 2 – 2 = 6 Background Problem Solution Technical Difficulties Milestones Questions
Problem • How do we process the information here? • How do researchers make sense out of it? E.g. 7000 records • Is there a better way to use the information here in a more aggregated context? • Can this information be shared among other users? Background Problem Solution Technical Difficulties Milestones Questions
Solution • To present the data in a way that is relevant to the bio informatics context • Visualizing the data in a very intuitive way Background Problem Solution Technical Difficulties Milestones Questions
Technical Difficulties • Deploying ex server • Understanding what the terms in the data mean • Transforming data into a useful format for analysis • Have to first analyze researchers’ difficulty Background Problem Solution Technical Difficulties Milestones Questions
Milestones • Wiki write up and proposal • Testing current NCBI system • Data cleaning • Building Panopticon solution • Deploying EX Server Background Problem Solution Technical Difficulties Milestones Questions
Questions Background Problem Solution Technical Difficulties Milestones Questions