Biology I
Biology I. Chapter 11—DNA: The Molecule of Heredity. Chapter 11 Section 2: From DNA to Protein. DNA has the info to make all proteins for an organism in code . The instructions have to be decoded so the cell can build the needed proteins. Section 2 Objectives – page 288.
Biology I
E N D
Presentation Transcript
Biology I • Chapter 11—DNA: The Molecule of Heredity
Chapter 11 Section 2: From DNA to Protein • DNA has the info to make all proteins for an organism in code. • The instructions have to be decoded so the cell can build the needed proteins.
Section 2 Objectives – page 288 Chapter 11 Section 2 Objectives • Relate the concept of the gene to the sequence of nucleotides in DNA. • Sequence the steps involved in the first part of protein synthesis, called “transcription”. • Sequence the steps involved in the second part of protein synthesis, called “translation”.
Section 2 Part 1 Vocabulary • Messenger RNA • Ribosomal RNA • Transfer RNA • Transcription • Codon
Section 11.2 Summary – pages 288 - 295 Genes and Proteins • As we previously learned, your DNA contains information that codes for the production of _____________________ proteins • Small nucleotide sequences in your DNA, called _________, code for the production of ___________ proteins genes different
Genes line up along your DNA almost like the cars in a __________ • Human DNA contains approximately ____________ genes train 30,000
Section 11.2 Summary – pages 288 - 295 • In chapter 6, we learned that proteins are polymers made up of subunits called ___________ __________ • Once fully made, proteins fold into complex, ____ - dimensional shapes amino acids 3
Section 11.2 Summary – page 288 - 295 • Proteins are made at __________________ ribosomes What/where are ribosomes in your cells? Little dots in the cytoplasm or on the ER
Section 11.2 Summary – page 288 - 295 Where is your DNA in a cell? In the nucleus So, to make a protein, the information inside of your ___________ must somehow get to a ______________ nucleus ribosome
damaged • DNA cannot leave the nucleus because it could get _______________ • Instead, another nucleic acid called __________, makes a copy of your genetic information for use by the cell when assembling ____________. RNA proteins
What does RNA stand for? • There are three types of RNA…each has a specific job during Protein Synthesis. • _________________________ • _________________________ • _________________________ • There are ____ differences between DNA and RNA Ribonucleic acid Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA) 3
Section 11.2 Summary – pages 288 - 295 Difference #1 • RNA is ________ stranded—it looks like one-half of a zipper • DNA is ________ stranded single double RNA nucleotide
Section 11.2 Summary – pages 288 - 295 Difference #2 Ribose • The sugar in RNA is ___________ • DNA’s sugar is _________________ ribose deoxyribose
Section 11.2 Summary – pages 288 - 295 Difference #3 • Both DNA and RNA have ____ nitrogenous bases, but RNA contains ____________ instead of ____________ 4 Uracil (U) Thymine (T) • ___ base pairs with ____ in RNA U A Uracil Hydrogen bonds Adenine
The first step in making a protein is called ________________ • Occurs in the __________ • The cell uses enzymes to make a copy of DNA that is called _________ RNA (mRNA) transcription nucleus messenger
Transcription Step 1 – DNA_________ opens up Nucleus A T T A C G G C A T DNA DNA
One Transcription Step 2 – ____ strand of mRNA is formed Nucleus A T T A C G G C A T U A G C U DNA DNA
Transcription Step 3 – mRNA is ________ processed • Not every portion of DNA is used to make proteins • Long noncoding regions are called __________ for _________________. • Regions containing coding information are called __________ for _______________. • ____________ cut out the introns and paste the __________ back together introns Intervening areas exons Expressed areas Enzymes exons
After enzymes cut out the introns, how would this strand of mRNA read? GUCUAGUCGAAUCGCGAUGCACCC Exon Exon Exon Intron Intron Intron GUC GCG CCC
Translation Step 1 – mRNA moves ____ of the nucleus into the cytoplasm to a ______________ out ribosome Nucleus A T T A C G G C A T U A G C U • Ribosome UAGCU DNA DNA
Translation: Step 2 • The amino acids that mRNA codes for will be brought to a ________________ by ___________ RNA where they will be put together to make a _____________ ribosome transfer protein
Section 11.2 Summary – pages 288 - 295 • There are ___ common amino acids that can be put together in different ways to make different proteins • Each group of ___ nitrogenous bases on mRNA codes for an amino acid • These groups are called ___________ • Circle the codons in the mRNA strand below AUGACGAACUGA 20 3 codons
Section 11.2 Summary – pages 288 - 295 Methionine (Start) What amino acid does AUG code for? The Messenger RNA Genetic Code First Letter Third Letter Second Letter U A G C U U Phenylalanine (UUU) Serine (UCU) Tyrosine (UAU) Cysteine (UGU) C Cysteine (UGC) Phenylalanine (UUC) Serine (UCC) Tyrosine (UAC) A Stop (UGA) Serine (UCA) Stop (UAA) Leucine (UUA) G Leucine (UUG) Serine (UCG) Stop (UAG) Tryptophan (UGG) C U Arginine (CGU) Leucine (CUU) Proline (CCU) Histadine (CAU) Arginine (CGC) Proline (CCC) C Leucine (CUC) Histadine (CAC) A Proline (CCA) Arginine (CGA) Leucine (CUA) Glutamine (CAA) Arginine (CGG) G Glutamine (CAG) Proline (CCG) Leucine (CUG) A U Isoleucine (AUU) Threonine (ACU) Asparagine (AAU) Serine (AGU) C Serine (AGC) Asparagine (AAC) Isoleucine (AUC) Threonine (ACC) A Arginine (AGA) Isoleucine (AUA) Threonine (ACA) Lysine (AAA) G Arginine (AGG) Methionine;Start (AUG) Threonine (ACG) Lysine (AAG) G Glycine (GGU) U Valine (GUU) Alanine (GCU) Aspartate (GAU) Valine (GUC) Aspartate (GAC) Glycine (GGC) Glycine (GGC) C Alanine (GCC) A Glycine (GGA) Alanine (GCA) Glutamate (GAA) Valine (GUA) Glutamate (GAG) Glycine (GGG) Alanine (GCG) G Valine (GUG)
Section 11.2 Summary – pages 288 - 295 What amino acid does ACG code for? threonine The Messenger RNA Genetic Code First Letter Third Letter Second Letter U A G C U U Phenylalanine (UUU) Serine (UCU) Tyrosine (UAU) Cysteine (UGU) C Cysteine (UGC) Phenylalanine (UUC) Serine (UCC) Tyrosine (UAC) A Stop (UGA) Serine (UCA) Stop (UAA) Leucine (UUA) G Leucine (UUG) Serine (UCG) Stop (UAG) Tryptophan (UGG) C U Arginine (CGU) Leucine (CUU) Proline (CCU) Histadine (CAU) Arginine (CGC) Proline (CCC) C Leucine (CUC) Histadine (CAC) A Proline (CCA) Arginine (CGA) Leucine (CUA) Glutamine (CAA) Arginine (CGG) G Glutamine (CAG) Proline (CCG) Leucine (CUG) A U Isoleucine (AUU) Threonine (ACU) Asparagine (AAU) Serine (AGU) C Serine (AGC) Asparagine (AAC) Isoleucine (AUC) Threonine (ACC) A Arginine (AGA) Isoleucine (AUA) Threonine (ACA) Lysine (AAA) G Arginine (AGG) Methionine;Start (AUG) Threonine (ACG) Lysine (AAG) G Glycine (GGU) U Valine (GUU) Alanine (GCU) Aspartate (GAU) Valine (GUC) Aspartate (GAC) Glycine (GGC) Glycine (GGC) C Alanine (GCC) A Glycine (GGA) Alanine (GCA) Glutamate (GAA) Valine (GUA) Glutamate (GAG) Glycine (GGG) Alanine (GCG) G Valine (GUG)
Section 11.2 Summary – pages 288 - 295 What amino acid does AAC code for? Asparagine The Messenger RNA Genetic Code First Letter Third Letter Second Letter U A G C U U Phenylalanine (UUU) Serine (UCU) Tyrosine (UAU) Cysteine (UGU) C Cysteine (UGC) Phenylalanine (UUC) Serine (UCC) Tyrosine (UAC) A Stop (UGA) Serine (UCA) Stop (UAA) Leucine (UUA) G Leucine (UUG) Serine (UCG) Stop (UAG) Tryptophan (UGG) C U Arginine (CGU) Leucine (CUU) Proline (CCU) Histadine (CAU) Arginine (CGC) Proline (CCC) C Leucine (CUC) Histadine (CAC) A Proline (CCA) Arginine (CGA) Leucine (CUA) Glutamine (CAA) Arginine (CGG) G Glutamine (CAG) Proline (CCG) Leucine (CUG) A U Isoleucine (AUU) Threonine (ACU) Asparagine (AAU) Serine (AGU) C Serine (AGC) Asparagine (AAC) Isoleucine (AUC) Threonine (ACC) A Arginine (AGA) Isoleucine (AUA) Threonine (ACA) Lysine (AAA) G Arginine (AGG) Methionine;Start (AUG) Threonine (ACG) Lysine (AAG) G Glycine (GGU) U Valine (GUU) Alanine (GCU) Aspartate (GAU) Valine (GUC) Aspartate (GAC) Glycine (GGC) Glycine (GGC) C Alanine (GCC) A Glycine (GGA) Alanine (GCA) Glutamate (GAA) Valine (GUA) Glutamate (GAG) Glycine (GGG) Alanine (GCG) G Valine (GUG)
Section 11.2 Summary – pages 288 - 295 What does UGA code for? Stop The Messenger RNA Genetic Code First Letter Third Letter Second Letter U A G C U U Phenylalanine (UUU) Serine (UCU) Tyrosine (UAU) Cysteine (UGU) C Cysteine (UGC) Phenylalanine (UUC) Serine (UCC) Tyrosine (UAC) A Stop (UGA) Serine (UCA) Stop (UAA) Leucine (UUA) G Leucine (UUG) Serine (UCG) Stop (UAG) Tryptophan (UGG) C U Arginine (CGU) Leucine (CUU) Proline (CCU) Histadine (CAU) Arginine (CGC) Proline (CCC) C Leucine (CUC) Histadine (CAC) A Proline (CCA) Arginine (CGA) Leucine (CUA) Glutamine (CAA) Arginine (CGG) G Glutamine (CAG) Proline (CCG) Leucine (CUG) A U Isoleucine (AUU) Threonine (ACU) Asparagine (AAU) Serine (AGU) C Serine (AGC) Asparagine (AAC) Isoleucine (AUC) Threonine (ACC) A Arginine (AGA) Isoleucine (AUA) Threonine (ACA) Lysine (AAA) G Arginine (AGG) Methionine;Start (AUG) Threonine (ACG) Lysine (AAG) G Glycine (GGU) U Valine (GUU) Alanine (GCU) Aspartate (GAU) Valine (GUC) Aspartate (GAC) Glycine (GGC) Glycine (GGC) C Alanine (GCC) A Glycine (GGA) Alanine (GCA) Glutamate (GAA) Valine (GUA) Glutamate (GAG) Glycine (GGG) Alanine (GCG) G Valine (GUG)
Transcription: Steps 3-5 3. Amino acids hook up using_________ bonds, which connect ________ & ________. 4. Once AAs are in place, the _______ leaves to pick up another _______ ______. 5. Once the _____ codon is reached, the new _______ strand leaves the ________ and moves into the ____ for distribution to other areas of the cell. peptide carbon nitrogen tRNA amino acid stop protein ribosome ER
Section 2 Vocabulary Review • Messenger RNA— carries info from DNA in nucleus into the cytoplasm • Ribosomal RNA—connects with mRNA, uses the info on it to assemble amino acids in proper order • Transfer RNA—delivers amino acids to ribosomes to be linked together into proteins
Section 2 Vocabulary Review • Transcription—process in nucleus where a copy of RNA is made from DNA • Codon—group of 3 nitrogenous bases in mRNA that code for a specific amino acid • Translation- The process of converting the info in an mRNA sequence into amino acids in protein chain in a ribosome.
Review: Objective 1 • Relate the concept of the gene to the sequence of nucleotides in DNA. Genes are small nucleotide sequences that make up our DNA
Review: Objective 2 • Sequence the steps involved in the first part of protein synthesis, called transcription. 1. DNA uncoils and __________ up. 2. RNA nucleotides make complementary ________ pairs with ______ strand of DNA. 3. Before the resulting _______________ RNA strand leaves the ______________, introns are ________ out and the _________ are pasted back together opens one base messenger nucleus cut exons
Review: Objective 3 • Sequence the steps involved in the second part of protein synthesis, called “translation”. • 1. mRNA ________ the nucleus and moves to a _________. • 2. ______ enters the ribosome, bringing various _______ _______ along. • 3. Amino acids are joined to each other by ________ bonds. • 4. ______ is released to go pick up another _______ _____. • 5. The final protein chain is sent to the _______ for transport to other parts of the cell. leaves ribosome tRNA amino acids peptide tRNA amino acid ER