prentice
Uploaded by
1 SLIDES
142 VUES
10LIKES

Sequence Analysis of Mitochondrial DNA Variants in szarvas23 Sample

DESCRIPTION

This document details the mitochondrial DNA sequences extracted from the szarvas23 sample. Each sequence is cataloged with its corresponding identifier and includes relevant genetic variations. The sequences range from positions 15977 to 16430, providing insights into the genetic makeup and possible phylogenetic relationships. This analysis can contribute to studies on mitochondrial variations, evolutionary biology, and ancestral genetics. Comprehensive analysis can enhance our understanding of genetic diversity and its implications among different populations.

1 / 1

Télécharger la présentation

Sequence Analysis of Mitochondrial DNA Variants in szarvas23 Sample

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. LAR LBR LCR LAF LBF LCF LDF LDR szarvas23-20 15977 ccaccattagcacccaaagctaagattctaatttaaactattctctgttctttcatggggaagcagatttgggtaccacc mit rCRS 15977 ................................................................................ szarvas23-20 16057 caagtattgactcacccatcaacaaccgctatgtatttcgtacattactgccagccaccatgaatattgtacggtaccat mit rCRS 16057 ................................................................................ szarvas23-20 16137 aaatacttgaccacctgtagtacataaaaacccaatccacatcaaaaccccctccccatgcttacaagcaagtacagcaa mit rCRS 16137 ................................................................................ szarvas23-20 16217 tcaaccttcaactatcacacatcaactgcaactccaaagcaacctctcacccactaggataccaacaaacctacccaccc mit rCRS 16217 ......c.................................c...c................................... szarvas23-20 16297 ttaacagtacatagtacataaagccatttaccgtacatagcacattacagtcaaatcccttctcgtccccatggatgacc mit rCRS 16297 ................................................................................ szarvas23-20 16377 cccctcagataggggtcccttgaccaccatcctccgtgaaatcaatatcccgca 16430 mit rCRS 16377 ...................................................... 16430 16261 16223 16257 (A) (B)

More Related