quanda
Uploaded by
43 SLIDES
944 VUES
540LIKES

PHARMACOGENOMICS

DESCRIPTION

PHARMACOGENOMICS. John N. van den Anker, MD, PhD, FCP, FAAP Children’s National Medical Center, Washington, DC, USA & Intensive Care, Erasmus MC-Sophia Children’s Hospital, Rotterdam, the Netherlands. Disclosure presentation John N. van den Anker.

1 / 43

Télécharger la présentation

PHARMACOGENOMICS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PHARMACOGENOMICS John N. van den Anker, MD, PhD, FCP, FAAP Children’s National Medical Center, Washington, DC, USA & Intensive Care, Erasmus MC-Sophia Children’s Hospital, Rotterdam, the Netherlands

  2. Disclosure presentation John N. van den Anker I do not have anything to disclose related to the content of my presentation

  3. Individual variability in drug response can have serious consequences Stevens-Johnson Syndrome (SJS) Adverse Drug Reaction

  4. Effectively treats or prevents disease The Ideal Medication Has no adverse effects

  5. Paradox of Modern Drug Development • Clinical trials provide evidence of efficacy and safety at usual doses in populations + = Efficacious & Safe 2. Physicians treat individualpatients who can vary widely in their response to drug therapy No Response + = Efficacious & Safe Adverse Drug Reaction

  6. 4-6thleading cause of death in the USA1 Health care costs: $137-177 billion annually (USA)2-3 Cause 7% of all hospital admissions4 Cause serious reactions in over 2,000,000 hospitalized patients (6.7%) each year in the USA1 Cause fatal reactions in over 100,000 hospitalized patients each year in the USA1 50% of newly approved therapeutic health products have serious ADRs, discovered only after the product is on the market (Health Canada, 2007) 95% of all ADRs are unreported Adverse Drug Reactions 1. Lazarou et al, JAMA, 1998 2. Johnson et al, Arch Intern Med 1995 3. Ernst et al, J. Am. Pharm. Assoc. 2001 4. Pirmohamed et al, BMJ, 2004 5. MjoÈrndal et al, EACPT3, 1999 6. Moore et al., 2007

  7. Factors Contributing to Variability in Drug Response Weight Gender Ethnicity Diet Compliance Genetic Factors Concomitant Disease 20-95% Concomitant Drugs Age Patient genotype is currently an unknown factor in the prescribing of medicines

  8. Disease Growth and Development Environment Genetics Determinants of Drug Response in Infants Absorption Distribution Receptor Interaction Biotransformation Excretion Exposure Response Drug

  9. The Challenge of Optimizing the Use of Medicines in Paediatric Patients: Determining the Source(s) of Variability…... Ontogeny Pharmacogenetics Variability

  10. From DNA to mRNA to protein ATG ATC CCC TTT Met Ile Pro Phe

  11. 3 billion correct basepairs ….and 1 mutation • atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcactacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgaattcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca • atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgacttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca gacgaattcagtacgtacatg gacgacttcagtacgtacatg

  12. CYP2D6 slow intermediate rapid ultrarapid anti-depressants, anti-psychotics, anti-arrhythmics, beta-blockers, pain medications, anti-emetics, anti-cancer drugs CYP2C19 Poor metabolizer normal anti-convulsants, proton pump inhibitors, benzodiazepines, anti-malarials

  13. Stable metabolites, Excretion Drug Drug Stable metabolites, Excretion CYP2D6 Pharmacogenetics EM PM “Functional” overdose

  14. CYP2D6 Pharmacogenetics • CYP2D6 activity displays bimodal distribution in Caucasian subjects • 5-10% of Caucasian population deficient in CYP2D6 activity • “Poor metabolizers” or “PMs” have two “inactive” forms (alleles) of the CYP2D6 gene • PMs at increased risk for concentration-dependent side effects with “normal” drug doses • Some drugs may not work (codeine; tramadol)

  15. CYP2D6 Pharmacogenetics: CaucasiansBertilsson et al. Clin. Pharmacol. Ther. 51:288-97, 1992 120 N = 1,011 80 Number of Individuals 40 12.6 0 0.01 0.1 1 10 100 Faster Slower CYP2D6 Activity

  16. CYP2D6 Activity: ChineseBertilsson et al. Clin. Pharmacol. Ther. 51:288-97, 1992 120 N = 1,011 N = 695 80 Number of Individuals 40 12.6 0 0.01 0.1 1 10 100 Faster Slower CYP2D6 Activity

  17. Individuals 40 30 20 10 0.1 100 1 10 MRS Unravelling CYP2D6 Pharmacogenetics EM Extensive Metabolizer Griese et al. Pharmacogenetics 1998, Raimundo et al. CPT 2004, Toscano et al. Pharmacogenetics 2006 UM ultrarapid metabolizer ~ 10-15 % IM Intermediate Metabolizer ~ 10-15 % PM Poor Metabolizer ~ 5-10 % Caucasians

  18. full-term healthy male infant • day 7 pp: intermittent periods of difficulty in breastfeeding • day 11: the baby had regained his birthweight • day 12: grey skin, milk intake had fallen • day 13: the baby was found dead • autopsy: no abnormality • blood concentration of morphine (metabolite of codeine): 70 ng/mL versus 0-2.2 ng/mL (typical)

  19. Pharmacogenetics of Codeine codeine site of action Cytochrome P450 2D6 Blood brain barrier 60 morphine 50 Poor Metabolizer 40 Extensive Metabolizer morphine [pmol/ml] 30 20 10 plasma morphine levels after 170 mg codeine p.o. 0 0 5 10 15 20 25 time [h] Eckhardt et al., Pain 1998

  20. Explanation: • medication mother due to episiotomy pain: codeine 60 mg plus paracetamol 1000 mg every 12 hrs for 2 weeks • Morphine concentration in stored milk: 87 ng/mL • mother: CYP2D6 genotype: CYP2D6*2x2 gene duplication = Ultra rapid metabolizer phenotype

  21. Prior to this publication! The American Academy of Pediatrics and “Drugs in Pregnancy in Lactation”, the major reference guide to fetal and neonatal risk, list codeine as compatible with breastfeeding • Briggs et al., 2005; Pediatrics, 2001

  22. Estimated 1846 newborn infants are at risk for this codeine ADR annually in Canada (340,000 births, 73% breastfed, 52% mothers receive codeine post-childbirth,1.4% risk genotype) FDA drug label change and public health advisories Health Canada Public Advisory May 10, 2006 Aug. 21, 2008 Aug 17, 2007

  23. August 20, 2009 • 2 year old boy • Received tonsillectomy for sleep apnea • Received standard codeine dose • Died of respiratory depression • High levels of morphine in blood • Boy carried CYP2D6 gene duplication • Kelly, Rieder, van den Anker et al. More codeine fatalities after • tonsillectomy in North American children. Pediatrics 2012;129(5):1343-7

  24. Transporters Receptors Phosphatases Targets 2nd messengers Protein kinases GI Lumen Blood Cell

  25. Opioids and pharmacogenomics Whypersonalizingopioidtherapy? • Wide unpredictableinterpatientvariability • Narrowtherapeutic indices  Inadequate painreliefand side effects ~ 50% • Genetic factors: up to 60% (Angst 2012) Sadhasivam et al. (2012)

  26. Candidate genes 1. 410 pain genes 2. <10% translated to human pain 3. Opioid + genetic ≈ 2000 hits

  27. Division of genes • Pharmacokinetic: affect the availability at the site of action Phase I and II enzymes, transporters etc. • Pharmacodynamic: target and downstream signalingcascade Mu-opioid receptor, inwardly rectifying potassium channel etc • Pain sensitivity: susceptibility to pain Sodiumchannel, interleukines etc.

  28. PK relatedgenes

  29. Metabolismfentanyl

  30. CYP3A4 Gene • Important drug metabolizingenzyme Highly expressed in liver and intestine broad substrate specificity (app. 50%) • Identified SNPs 22 allelesidentified (CYPallele homepage) Rare or lackphenotypic effect • Caucasian *1G and *22 allele

  31. CYP3A4 SNPs CYP3A4*1G  reducedactivity  higher plasma levels • Lessfentanylrequired • More side effects Studies Dong (2012),Yuan (2011)and Zhang (2010): Lowerfentanylrequirementpostoperative Yuan (2011) correlation between plasma levels and requirement (r=-0.552, p<0.001) However, notassociatedwithAEsandPain score CYP3A4*22

  32. PD relatedgenes

  33. OPRM1 and Fentanyl 118A>G • Higherfentanylrequirement (Zhang 2011) • Higher VAS pain score (Wu 2009) 118A>G relevant? Liao 2013: N=97, post-operative pain, fentanylrequirement+AEs CYP3A4*18 >> A118G 304A>G Lowerfentanylrequirement (Landau 2009) Association with morphine requirement not found (Wong 2010)

  34. OPRM1 relatedgenes Stat6

  35. Painsensitivitygenes

  36. Painsensitivitygenes Action potential • SCN9A Α-subunit Nav1.7 channel, nociceptive neurons R1150W  increasedsensitivitytopain (Reimann 2010) • KCNS1 Voltage gated K channel (Kv 9.1), sensory neurons 1465A>G  increasedsensitivitytopain (Costigan 2010)

  37. NICU study • n=132 • Mechanicalventilation (PNA<3 days) • 2 level III NICUs • Continousmorphinevs placebo during max. 7 days • Loadingdose 100 µg/kg  10 µg/kg/hr • Additionalmorphine (50 µg/kg  5-10 µg/kg/hr) Objective Determineifpolymorphisms in PD relatedgenes (OPRM1 118A>G, COMT Val158Met, ARRB2 8622C>T) are associatedwithadditionalmorphinerequirement (AMR) in newborns.

  38. Results NICU *corrected OR and 95%CI for postconceptional age, sex, allocation group, location centre .  OPRM1 and COMT significant after Bonferroni correction

  39. Pharmacogenomics • Avoid adverse drug reactions • Maximize drug efficacy for individual patients Pharmacogenetic Profile: Highrisk of ADR (50%): All Patients with Same Diagnosis treat with alternative drug or dose Moderate risk of ADR (12.5%): treat with alternative drug or dose 10% risk of adverse reaction Low risk of ADR (0%): treat with conventional dose

  40. What do we need to do! All children are at risk for ADRs, but not all children are at equal risk. Find the kids at highest risk for serious ADRs due to genetic factors

  41. Identify children with ADRs • Identify ‘matched’ children on same medications, without ADRs • Whenever possible, DNA samples are collected from biological parents of ADR patients • Look for genetic variation in key drug ADME enzymes • Develop new dosing guidelines • Bedside-benchtop-bedside science

  42. WE CAN’T TREAT CHILDREN LIKE ADULTS Increased Risk of Severe ADRs in Children >75% of approved drugs used in children are untested in pediatric populations Young children cannot evaluate or express their own response to medications Pediatric dosage forms not available Children metabolize and transport drugs differently than adults

More Related