ravi
Uploaded by
52 SLIDES
1266 VUES
570LIKES

Ribozyme Catalysis

DESCRIPTION

Ribozyme Catalysis. Brooke Richardson Gellman Group April 17, 2008. RNA World. hypothesis about the origin of life RNA served two roles information storage catalysts RNA’s role has mostly been superseded DNA-information storage proteins-catalysts

1 / 52

Télécharger la présentation

Ribozyme Catalysis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Ribozyme Catalysis Brooke Richardson Gellman Group April 17, 2008

  2. RNA World • hypothesis about the origin of life • RNA served two roles • information storage • catalysts • RNA’s role has mostly been superseded • DNA-information storage • proteins-catalysts • ribozymes are remnants from the RNA world Gilbert, W. Nature.1986, 319, 618.

  3. Ribozymes • enzyme composed of RNA • found in all organisms • ribosome • RNAse P • group I intron • 100 to thousands of bases • formerly all believed to be metalloenzymes group I intron Scott, W. Curr. Opin. Struct. Biol.2006, 16, 319–326.

  4. Ribozymes vs. Proteins -RNAOH Bevilacqua, P. and Yajima, R. Curr. Opin. Chem. Biol.2006, 10, 455-464. Raines, R. Chem. Rev.1998, 98, 1045-1065.

  5. RNA Nucleobases pKa=9.4 pKa=9.4 Uracil (U) Guanine (G) pKa=4.5 pKa=3.5 pKa=1.5 (estimated) Adenine (A) Cytosine (C) Blackburn, G., Michael, J., et. al. Nucleic Acids in Chemistry and Biology, 2nd ed.1996.

  6. Base pairs-Tertiary structure A-U base pair G-C base pair Base pairing base stacking Holbrook, S. Curr. Opin. Struct. Biol. 2005, 15, 302-308.

  7. Tertiary structure Activity requires packing of individual helices and loops electrostatic repulsion phosphodiester Stabilization by tertiary base interactions by metals A-minor motif Holbrook, S. Curr. Opin. Struct. Biol. 2005, 15, 302-308.

  8. Enzyme kinetics k2 + k-1 k2[E][S] Km = kobs = k1 [S] + Km k 1 k2 E + P Steady State Approximation: E + S ES k -1 • under nonsaturating conditions, binding can obscure the chemistry • fails if intermediate concentration becomes large When [S]>>>[E] and Km small kobs = k2[E] Jencks, W. Catalysis in Chemistry and Biology.1969.

  9. Non steady state kinetics k1k3[S] steady state kobs = k1[S] + k2 product pre-steady state time k3 k1 I E + S E + P k2 k4 Assumptions: k2>>k3 k4 is negligible Strickland, S., Massey, V., et. al. J. Biol. Chem. 1975, 250, 4048-4052.

  10. Outline • Hammerhead ribozyme acid/base catalysis 2) glmS ribozyme cofactor assisted catalysis 3) Ribosome substrate positioning 4) UV1C deoxyribozyme electron transfer

  11. Hammerhead ribozymes • self cleaving RNA • found in viroid/viruses • cleaves specifically at C17 • invariant core residues Bevilacqua, P. and Yajima, R. Curr. Opin. Chem. Biol.2006, 10, 455-464.

  12. Cyclic phosphodiester formation   • Catalyst provides: • general base/general acid • positioning of reactants Bevilacqua, P. and Yajima, R. Curr. Opin. Chem. Biol.2006, 10, 455-464.

  13. Mg2+ not required for catalysis all ribozymes thought to be metalloenzymes high salt purification resulted in cleavage metal ions promote folding HH16.1 Murray, J., Scott, W., et. al. Chem. Biol.1998, 5, 587-595.

  14. Possible role for Mg2+ migration of Mg2+ during reaction • better positioning • activation of G8 2-’OH Lee, T., York, D., et. al. J. Am. Chem. Soc.2008, 130, 3053-3064.

  15. Initial hammerhead structure G8 G12 C17 • G12 and G8 critical for activity • 20 Ǻ away from cleavage site (C17) • Hypothesis: there is a more compact active structure Pley, H., McKay, D., et. al. Nature. 1994, 372, 68-74. Bevilacqua, P. and Yajima, R. Curr. Opin. Chem. Biol.2006, 10, 455-464.

  16. Footprinting Analysis crosslink digestion/ electrophoresis substrate enzyme Electrophoresis direction example reagent: 5-IodoU sequencing crosslinking indicates close contact

  17. Catalytic core Rz 6-SdG5 2-AP5 2-AP8 6-SdG8 2-AP12 dC17.HH5 6-thiodeoxyguanine 6SdG 2-aminopurine 2-AP crosslinking reveals a more compact structure than in the crystalline state Heckman, J., Burke, J., et. al. Biochemistry. 2005, 44, 4148-4156.

  18. Dependence of rate on pH pH log kobs pKa= 7 Model for general base catalysis-one ionizable group sharp rate increase until pKa Bevilicqua, P. Biochemistry. 2003, 42, 2259-2265.

  19. Hammerhead pH dependence G12 mutational analysis G 2AP diAP diAP G I pKa=9.6 pKa=5.1 pH I 2AP pKa=8.7 pKa=3.6 suggests base with high pKa evidence that G12 is the general base Han, J., and Burke, J. Biochemistry. 2005, 44, 7864-7870.

  20. Role of G8 full length hammerhead G8 pairs with C3 G8 has a structural role Martick, M., Scott, W. Cell. 2006, 126, 309-320.

  21. Key Points-Hammerhead ribozyme • not critically dependent upon metals • Mg2+ may play a role in catalysis • employs general acid/general base catalysis • conformational flexibility required to achieve active state

  22. Outline • Hammerhead ribozyme acid/base catalysis 2) glmS ribozyme cofactor assisted catalysis 3) Ribosome substrate positioning 4) UV1C deoxyribozyme electron transfer

  23. glmS ribozyme • regulates expression from glmS gene • found in gram positive bacteria • binds GlcN6P • Activates upon binding GlcN6P • potential antibacterial target GlcN6P Reaction: Winkler, W., Breaker, R., et. al. Nature. 2004, 428, 281.

  24. glmS ribozyme structure • 75 bases required for activity • GlcN6P binds in core • loops P3 and P4 play structural role Winkler, W., Breaker, R., et. al. Nature. 2004, 428, 281.

  25. glmS ribozyme crystal structure • no significant structural change upon cofactor binding • no metal in the catalytic core Klein, D., and Ferré-D-Amaré, A. Science. 2006, 313, 1752-1756.

  26. glms ribozyme cofactors none GlcN6P tris GlcN Glc6P cofactor uncleaved cleaved GlcN GlcN6P Tris Glc6P McCarthy, T., Soukup, G., et. al. Chem. Biol.2005, 12, 1221-1226.

  27. Cofactor serves as base 3 1 2 Analog 1 Winkler, W., Breaker, R., et. al. Nature. 2004, 428, 281. Lim, J., Breaker, R., et. al. Angew. Chem. Int. Ed. 2006, 45, 6689-6693.

  28. Key points-glmS ribozyme • ribozyme as well as riboswitch • cofactor serves as general base

  29. Outline • Hammerhead ribozyme acid/base catalysis 2) glmS ribozyme cofactor assisted catalysis 3) Ribosome substrate positioning 4) UV1C deoxyribozyme electron transfer

  30. Ribosome Bacteria/Archeae • ribonucleoprotein complex • catalyzes peptide bond formation • responsible for all protein synthesis in the cell • two subunits • 50S (60S): catalytic subunit • 23S rRNA, 5S rRNA, proteins (50S) 30S 50S Eukaryote 40S 60S Rodnina, S., Beringer, M., et. al. Trends. Biochem. Sci. 2007, 32, 20-26

  31. Ribosome sites P site: peptidyl-tRNA A site: aminoacyl-tRNA Borman, S. Chem. Eng. News. 2007, 85, 13-16

  32. Peptide bond formation Catalyst provides: • general base/general acid • stabilize charge buildup in intermediate • positioning of reactants +

  33. Ribosome structure • active site solely RNA • no protein within 15 Ǻ of active site • proposed A2451 N3 (E. coli numbering) as general base A H. marismortui 50S subunit Nissen, P., Steitz, T., et. al. Science. 2000, 289, 920-930.

  34. Ribosomal activity measurements Fragment reaction puromycin A-site substrate formyl-[35S]Met-tRNA P-site substrate • requires methanol • minimal substrates: do not make all the contacts tRNA does

  35. pH dependence of peptidyl transfer • only in the fragment reaction • implicates general base catalysis • use of A2451 as general base requires shift of pKa from 1.5 to ~7.5 • charge relay system proposed to cause shift log (kobs) pH A2451 G2447 Katunin, V., Rodnina, M., et. al. Mol. Cell.2002, 10, 339-346. Nissen, P., Steitz, T., et. al. Science. 2000, 289, 920-930.

  36. Mutational analysis of A2451/G2447 • Mutation of G2447 does not significantly effect activity • Does not remove pH dependence • A2451 is not general base Assay I: fragment reaction Assay III: A-site- CC-puromycin P-site- N-acetyl-Phe-tRNA Polacek, N., Mankin, A., et. al. Nature. 2001, 411, 498-501.

  37. Ribosomal molecular dynamics simulation • no evidence for nucleobase of A2451 as general base • involvement of A2451 2’OH A active site schematic- molecular dynamics simulation Trobo, S., Aqvist, J. Proc. Nat. Acad. Sci. 2005, 102, 12395-12400.

  38. Gapped-cp-reconstitution Ribosomal 23S RNA delete synthetic fragment 3’ 5’ 3’ 5’ close Erlacher, M., Polacek, N., et. al. J. Am. Chem. Soc. 2006, 128, 4453-4459.

  39. A2451 2’-OH is necessary synthesized sequence: CCCGGGGAUAACAGGCUGAUCUCCCC 2451 RNA DNA Erlacher, M., Polacek, N., et. al. J. Am. Chem. Soc. 2006, 128, 4453-4459.

  40. Thermodynamics ( ) Ea 1 ln k = ln A - R T -2.3RTlog( ) k h ΔG‡ = kbT Arrhenius plot ΔH‡ = Ea – RT slope = -Ea/R ln k 1/T (K-1) R- gas constant h- Boltzmann’s constant kb- Planck’s constant TΔS‡ = ΔH‡ - ΔG‡ Wynne-Jones, W., Eyring, H. J. Chem. Phys. 1935, 3, 492-502.

  41. Entropy trap • ribosome positions substrates • provides favorable entropy Beringer, M., Rodnina, M., et. al. J. Biol. Chem. 2005, 208, 36065-36072.

  42. Key points-ribosome • intricate network of hydrogen bonds • acid/base catalysis is negligible • freezes active conformation

  43. Outline • Hammerhead ribozyme acid/base catalysis 2) glmS ribozyme cofactor assisted catalysis 3) Ribosome substrate positioning 4) UV1C deoxyribozyme electron transfer

  44. Pyrimidine dimers • photochemically allowed 2+2 cycloaddition • excited by UV light • results in problems with DNA replication/transcription • repaired by photolyase (non-placental animals) • significant problem in RNA world [2+2] + Chinnapen, D. and Sen, D.. Proc. Nat. Acad. Sci. 2004, 101, 65-69.

  45. UV1C deoxyribozyme • selected in vitro to repair thymine dimers • requires light (Φmax at 305 nm) • forms guanine quadruplex ANa-ALi wavelength (nm) Chinnapen, D. and Sen, D.. Proc. Nat. Acad. Sci. 2004, 101, 65-69.

  46. In vitro selection of UV1C 1014 variants primer incorporation selection: UV irradiation strand separation Chinnapen, D. and Sen, D.. Proc. Nat. Acad. Sci. 2004, 101, 65-69.

  47. Core active site-Footprinting T16 5-IU electrophoresis direction 5-IodoU 5-IU key contacts with G21/G22/G23/G25 and G18 Chinnapen, D. and Sen, D.. J. Mol. Biol. 2007, 365, 1326-1336.

  48. Mutational Analysis [2+2] + ~500 kJ/mol hu305= 393 kJ/mol hypothesis: electron transfer reaction inosine guanine Chinnapen, D. and Sen, D.. J. Mol. Biol. 2007, 365, 1326-1336.

  49. Key points-UV1C • nucleic acids can repair thymine dimers • ribozyme electron transfer reaction

  50. Conclusions • Ribozymes use a variety of methods to catalyze reactions, including acid-base catalysis. • Not all ribozymes use metals in catalysis. • Ribozymes can achieve large rate accelerations.

More Related