1 / 9

DEVELOPMENT OF A PCR BASED TEST TO DIFFERENTIATE PADDLEFISH AND STURGEON EGGS

DEVELOPMENT OF A PCR BASED TEST TO DIFFERENTIATE PADDLEFISH AND STURGEON EGGS. Scott Cooper, Jill Mader, Sue Kittleson, Valerie Hyde, Marc Rott Biology/Microbiology Department, University of Wisconsin-La Crosse, La Crosse, WI 56401. Sample Preparation.

ray
Télécharger la présentation

DEVELOPMENT OF A PCR BASED TEST TO DIFFERENTIATE PADDLEFISH AND STURGEON EGGS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DEVELOPMENT OF A PCR BASED TEST TO DIFFERENTIATE PADDLEFISH AND STURGEON EGGS Scott Cooper, Jill Mader, Sue Kittleson, Valerie Hyde, Marc RottBiology/Microbiology Department, University of Wisconsin-La Crosse, La Crosse, WI 56401

  2. Sample Preparation • Eggs kept on ice until freezing at -80oC • Single egg mashed with sterile glass rod in 200 ul buffer (20 mM Tris, 20 mM KCl, 0.5% Tween 20, 5% Chelex, 0.2 mg/ml proteinase K) • Samples incubated 1.5 hours at 55oC • Samples incubated 8 minutes at 95oC • Samples centrifuged at 14,000 rpm for 10 minutes • An aliquot was removed for PCR amplification (0.01-1 ul)

  3. 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ Polymerase Chain Reaction (PCR) CBR1 Mix together... • Sample DNA • dNTPs • Buffer • Taq DNA Polymerase • PCR Primers CBL1 TGATGAAATTTTGGCTCACT CBR1 GTGGAAGGCGAAGAATCG CBL1 95oC 55oC 72oC

  4. Cytochrome b DNA Sequences • PCR products from paddlefish, shovelnose sturgeon and lake sturgeon were cloned and sequenced. Table 1. Percent DNA Sequence Identity Shovelnose Lake 86.6% 86.0% Paddlefish Lake 90.8%

  5. Restriction Enzyme Digestion Mix together : • 1 ul PCR product • 8 ul buffer and water • 1 ul restriction enzyme Incubate 30 min, 37oC. Subject sample to agarose gel electrophoresis for 45 minutes. Stain gel with ethidium bromide and photograph.

  6. HincII PA SN LK NarI HincII Restriction Mapping Restriction enzymes cut DNA at specific sites. A single change in the sequence of that site will prevent cleavage. Example: HincII cuts GTTAAC in paddlefish cyt b DNA but not GTAAAC in sturgeon cyt b DNA

  7. PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp Figure 3. Restriction digest of PCR products with the restriction enzyme HincII. Samples were run on a 3% Methaphor agarose gel.

  8. PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp Figure 4. Restriction digest of PCR products with the restriction enzyme NarI . Samples were run on a 1% LE agarose gel.

  9. Conclusions • Enough DNA can be isolated from a single fish egg to allow for sucessful PCR amplification. • DNA sequence analysis demosnstrates unique genetic markers in paddlefish, and in shovelnose, pallid and lake sturgeon. • This assay will allow the species identification of a single egg within one day. • To date this assay has been tested on more than thirty fish, from all over the country, with no observed discrepancies in the assay.

More Related